RHD: Alleles by name

DesignationISBT nameHaplotypePhenotypeClusterStructureFirst mentionDefinitive publication
D186Tnot reportedDIVa clusterRHD(L62F)2012
DIIIa150Cnot reportedDIVa clusterRHD(150T>C,L62F,A137V,N152T,T201R,F223V,819G>A)2012
RHD(G353V)not reportedEurasian D clusterRHD(G353V)2012
RHD(L216F)not reportedEurasian D clusterRHD(L216F)2012
RHD(L228Q)not reportedEurasian D clusterRHD(L228Q)2012
RHD(P313P)not reportedEurasian D clusterRHD(P313P)2012
RHD(V352I)not reportedEurasian D clusterRHD(V352I)2012
RHD(147A>G)not reportedEurasian D clusterRHD(147A>G)20112012
RHD(1347A>G)cDeEurasian D clusterRHD(1347A>G)20032003
RHD(27del13)not reportedEurasian D clusterRHD(27del13)2012
RHD(29del14)not reportedweakened D expressionEurasian D clusterRHD(29del14)20122012
CcdeD negativeDIVa clusterRHD(L62F,A137V,N152T)-RHCE(4-7)-RHD(G336C)20042004
CcdeD negativeDIVa clusterRHD-RHCE(4-7)-RHD(G336C)20092009
cDePartial DDIVa clusterRHD(L62F,A137V,N152T,M170T,F223V)2012
D667see DFV
D674not reportedEurasian D clusterRHD(S225F)20022002
DALsee DV type 7
cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
cDePartial Dweak D type 4 clusterRHD(T201R,T203A,F223V,I342T)20122012
cDePartial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[957G>A]20062006
DAR1 (weak D type 4.2.0)RHD*09.01.00
cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)19981999
not reportedPartial Dweak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]
cDeD positive (apparently normal)
Partial D
DAU clusterRHD(T379M)20022002
cDeDAU clusterRHD(579G>A,1136C>T)20032003
not reportedEurasian D clusterRHD(150T>C,1136C>T)
cDePartial DDAU clusterRHD(S230I,T379M)20022002
not reportedD positive (no further data)DAU clusterRHD(V247L,T379M)[579G>A]20122012
cDeweakened D expressionDAU clusterRHD(A85V,V279M,T379M)20122016
cDeDAU clusterRHD(L181P,T379M)2012
cDeDAU clusterRHD(W16C,T379M)2013
cDeD positive (no further data)DAU clusterRHD(S68N,T379M)[201G>A]20142014
cDePartial D
weakened D expression
DAU clusterRHD(R70Q,S333N,T379M)20022002
cDePartial DDAU clusterRHD(V279M,T379M)20022002
cDePartial D
weakened D expression
DAU clusterRHD(E233K,T379M)20022002
cDePartial DDAU clusterRHD(F223V,E233Q,T379M)20052005
cDeweakened D expressionDAU clusterRHD(F223V,E233Q,T379M)[1122C>T]20142016
cDePartial DDAU clusterRHD(S333N,T379M)20052005
cDePartial DDAU clusterRHD(V279M,S333N,T379M)20092009
not reportedD positive (no further data)DAU clusterRHD(R114W,T379M)[579G>A]20122012
not reportedD positive (no further data)DAU clusterRHD(F179L,T379M)20122012
not reportedweakened D expressionEurasian D clusterRHD(L227P)20032004
DBO-1see RHD(165C>T)
DBO-2not reportedweakened D expressionEurasian D clusterRHD(357T>C)2006
DBO-3not reportedEurasian D clusterRHD(P323H)2006
CDePartial DEurasian D clusterRHD-RHcE(5:667-5:712)-RHD19961996
cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:800)-RHD20012001
cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
CDePartial DEurasian D clusterRHD-RHCe(5-7)-RHD19961996
CDePartial DEurasian D clusterRHD-RHCe(5-9)-RHD19991999
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
CDePartial DEurasian D clusterRHD(A226D)20072012
cDEPartial DEurasian D clusterRHD(F223V,A226P)19992008
cDEPartial DEurasian D clusterRHD(A226P)20082008
DCS-3see DBS-2
not reportedPartial DEurasian D clusterRHD(D40E)2007
not reportedPartial DEurasian D clusterRHD(D164N)2008
not reportedDELEurasian D clusterRHD(A280T)20142014
CDeDELEurasian D clusterRHD(X418K)20152015
DFEsee weak D type 38
CDePartial DEurasian D clusterRHD(Y165C)20052007
multiplePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD19951995
CDePartial DEurasian D clusterRHD-RHCE(4)-RHD19971997
CDePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD(G180A)20072007
CDePartial DEurasian D clusterRHD-RHCE(4:505-4:509)-RHD20092012
not reportedPartial DEurasian D clusterRHD-RHCE(3-4)-RHD2007
multiplePartial Dweak D type 4 clusterRHD(F223V)20022002
DFV.1cDeweakened D expressionweak D type 4 clusterRHD(F223V)20132014
CDePartial DEurasian D clusterRHD(H166P)19982009
DHARcdePartial DEurasian D clusterRHCE-RHD(5)-RHCE19961996
CDePartial DEurasian D clusterRHD(E233K)19981999
cDEPartial DEurasian D clusterRHD(T283I)1996
DHMiicDEPartial DEurasian D cluster1996
CDePartial D
weakened D expression
Eurasian D clusterRHD(K235T)20012001
not reportedPartial DEurasian D clusterRHD(H171Q)2004
not reportedPartial DEurasian D clusterRHD(R229K)19971997
CDePartial D
D category
Eurasian D clusterRHD(A354D)19971997
DIII type 4RHD*03.04
CDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T)20002000
DIII type 4.2RHD*03.04.02
not reportedEurasian D clusterRHD(L62F,S103P,A137V,N152T)
DIII type 5RHD*03.01
cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,T201R,F223V)
DIII type 6RHD*03.06
cDePartial D
D category
DIVa clusterRHD(A137V,N152T,T201R,F223V,A273A)20052006
DIII type 7RHD*03.07
cDePartial D
D category
DIVa clusterRHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)20052006
DIII type 8RHD*03.08
not reportedPartial D
D category
DIVa clusterRHD(A137V,N152T)2010
DIII type 9RHD*03.09
not reportedPartial DDIVa clusterRHD(L62F,A137V,N152T,F223V)
DIIIaambiguous over time
DIIIa-ceS(1-2)-D(3)-ceS(4-7)-Dnot reportedDIVa clusterDIIIa-ceS(1-2)-D(3)-ceS(4-7)-D2017
DIIIbambiguous over time
CDePartial D
D category
Eurasian D clusterRHD-RHCE(3)-RHD19961996
cDEPartial D
weakened D expression
Eurasian D clusterRHD(C285Y)20002000
DIT-1CDeweakened D expressionEurasian D clusterRHD(I288T)2005
DIT-2CDeweakened D expressionEurasian D clusterRHD(I288F)2011
DIV type 1.0RHD*04.01
cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,D350H)2012
DIV type 3RHD*04.03
CDePartial D
D category
Eurasian D clusterRHD-RHCE(6-9)-RHD19991999
DIV type 4RHD*04.04
CDePartial D
D category
Eurasian D clusterRHD-RHCE(7:1048-7:1061)-RHD1998
DIV type 5RHD*04.05
cDEPartial D
D category
Eurasian D clusterRHD-RHCE(7-9)-RHD20002000
DIV(S103P)cDeDIVa clusterRHD(L62F,S103P,A137V,N152T)2013
DIVa-likeRHD*04.01.02not reportedEurasian D clusterRHD(L62F,A137V,N152T,F223V,D350H)
DIVb (J)see DIV type 5
DIVb type 2RHD*04.06
CDePartial DEurasian D clusterRHD-RHCE(7:1048-9)-RHD19951995
DKGnot reportedDEL
Partial D
Eurasian D clusterRHD(1155-412del1012)20172017
cDEPartial DEurasian D clusterRHD-RHCE(2-3)-RHD20002001
DLAsee weak D type 39
not reportedweakened D expression
Partial D
Eurasian D clusterRHD(S284L)20032004
cDEPartial DEurasian D clusterRHD(F223V)-RHCE(5:712-6)-RHD20122012
cDeEurasian D clusterRHD(L207F)20032003
cDePartial DEurasian D clusterRHD(L54P)1999
CDePartial DEurasian D clusterRHD(M170I)20082009
CDePartial DEurasian D clusterRHD(M170I)2010
cDEPartial DEurasian D clusterRHD(G357D)2005
CDePartial DEurasian D clusterRHD(G355S)20022002
not reportedPartial DEurasian D clusterRHD(N162S)2006
DNTCDePartial DEurasian D clusterRHD(N152T)20092013
cDEPartial DEurasian D clusterRHD(G353R)19971997
cDePartial Dweak D type 4 clusterRHD(M170T,F223V)19992009
not reportedPartial Dweak D type 4 clusterRHD(M170T,F223V,L378V)20052009
not reportedPartial Dweak D type 4 clusterRHD(A137V,M170T,F223V)2005
not reportedPartial DDIVa cluster
DROsee weak D type 37
DTIsee DBS-1
not reportedweakened D expression
Partial D
weak D type 4 clusterRHD(F223V,S225F)20052005
DUC-1not reportedD positive (apparently normal)Eurasian D clusterRHD(636C>T)20052005
not reportedD positive (apparently normal)Eurasian D clusterRHD(V245L)20052005
DUC-3RHD*01.01CDeD positive (apparently normal)Eurasian D clusterRHD(W16C)2010
DV (FK)see DV type 1
DV (Hus)see DV type 2
DV (Jpn)see DV type 6
DV (Kou)see DV type 1
DV type 1RHD*05.01
CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:697)-RHD19951995
DV type 10RHD*05.10
not reportedPartial DEurasian D clusterRHD-RHCE(5-6)-RHD
DV type 2RHD*05.02
CDePartial D
D category
Eurasian D clusterRHD-RHCE(5)-RHD19951995
DV type 3see DBS-0
DV type 4RHD*05.04
CDePartial D
D category
Eurasian D clusterRHD(E233Q)19981999
DV type 5see DHK
DV type 6RHD*05.06
CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:712)-RHD19981999
DV type 7RHD*05.07
CDeD category
Partial D
Eurasian D clusterRHD-RHCE(5:667-5:787)-RHD20012001
DV type 8RHD*05.08
CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:744)-RHD19981999
DV type 9RHD*05.09
CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:697-5:712)-RHD19992000
DVa (SM)see DV type 4
DVa (TO)see DV type 9
DVa (TT)see DV type 8
DVa 2see DV type 8
DVa 3see DV type 4
DVa 4see DV type 2
DVI type 1RHD*06.01
cDED category
Partial D
Eurasian D clusterRHD-RHcE(4-5)-RHD19971997
DVI type 2RHD*06.02
CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(4-6)-RHD19941994
DVI type 3RHD*06.03
CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(3-6)-RHD19981998
DVI type 3.2RHD*06.03.02
not reportedPartial DEurasian D clusterRHD-RHCE(3-6)-RHD(A399T)
DVI type 4RHD*06.04
CDePartial D
D category
Eurasian D clusterRHD-RHCE(3-5)-RHD20002006
CDePartial D
D category
Eurasian D clusterRHD(L110P)19951995
DVII type 2RHD*07.02
CDePartial DEurasian D clusterRHD(S103P,L110P)20012001
not reportedPartial DEurasian D clusterRHD(229delR)20042006
not reportedPartial D
weakened D expression
Eurasian D clusterRHD(235delK)20062006
CDePartial DEurasian D clusterRHD(M358T)20042004
cDePartial DEurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20132013
cDePartial DEurasian D clusterRHD(R234W)20032005
Please choose other namenot reportedPartial D
weakened D expression
Eurasian D clusterRHD(D164E)2017
RHCE(1)-D(6)-CE(7-10)RHD*01N.42CdeD negativeno RHDRHCE(1)-RHD(6)-RHCE(7-10)20022002
RHCE(1-3)-RHD(4-10)RHD*01N.43cDED negativeEurasian D clusterRHD(Hybrid RHCE(1-3))20042009
RHCE(1-9)-RHDRHD*01N.02cDED negativeEurasian D clusterRHCE(1-9)-RHD20012001
RHD deletionRHD*01N.01
cdeD negativeno RHDRHD(del exon 1 to 10)19911991
RHD delEx3 type 1not reportedEurasian D clusterRHD(335+649del10625)2017
RHD psiRHD*08N.01
cDeD negativeweak D type 4 clusterRHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)20002000
RHD(-10C>T)CDeweakened D expressionEurasian D clusterRHD(-10C>T)2012
RHD(1026insAC)not reportedEurasian D clusterRHD(1026insAC)2014
RHD(1056C>G)not reportedweakened D expressionEurasian D clusterRHD(1056C>G)2017
RHD(1065C>T)CDeweakened D expressionEurasian D clusterRHD(1065C>T)20142014
RHD(1067insA)not reportedEurasian D clusterRHD(1067insA)2017
RHD(1080del10)RHD*01N.36not reportedD negativeEurasian D clusterRHD(1080del10)2010
RHD(1166delA)not reportedEurasian D clusterRHD(1166delA)2013
RHD(1174delA)RHD*01N.66not reportedEurasian D clusterRHD(1174delA)
RHD(1209delT)not reportedEurasian D clusterRHD(1209delT)2014
CDeDELEurasian D clusterRHD(1227G>A)20012001
RHD(1228-2del21)RHD*01N.44not reportedD negativeEurasian D clusterRHD(1228-2del21)2014
CDeDELEurasian D clusterRHD(1248insG)20142014
RHD(124delAA)RHD*01N.65not reportedEurasian D clusterRHD(124delAA)
RHD(1269G>C)CDeweakened D expressionEurasian D clusterRHD(1269G>C)20112012
not reportedD negativeEurasian D clusterRHD(142delM)
RHD(147del A)RHD*01EL.04
CDeDELEurasian D clusterRHD(147del A)20042009
RHD(165C>T)not reportedD positive (apparently normal)
weakened D expression
Eurasian D clusterRHD(165C>T)
RHD(201A,203A,1136T)not reportedDAU clusterRHD(201G>A,203G>A,1136C>T)2014
RHD(207insT)not reportedD negativeEurasian D clusterRHD(207insT)2017
RHD(216dupCA,1195G>A)RHD*01N.45CDeD negativeEurasian D clusterRHD(216dupCA,1195G>A)2012
RHD(255G>A, 1227G>A,)not reportedEurasian D clusterRHD(255G>A, 1227G>A,)2017
RHD(26dupL)not reportedweakened D expressionEurasian D clusterRHD(26insL)20112011
RHD(297del23)RHD*01N.37not reportedD negativeEurasian D clusterRHD(297del23)2013
RHD(325delA)RHD*01N.11CDeD negativeEurasian D clusterRHD(325del A)20072007
RHD(330delGT)RHD*01N.35not reportedD negativeEurasian D clusterRHD(330delGT)20072007
RHD(343del C)RHD*01N.23CDeD negativeEurasian D clusterRHD(343del C)20042009
RHD(356de11)not reportedEurasian D clusterRHD(356de11)2012
RHD(361del11)RHD*01N.41CDeD negativeEurasian D clusterRHD(361del11)20142014
RHD(384T>C)not reportedEurasian D clusterRHD(384T>C)
RHD(396insGG)not reportedEurasian D clusterRHD(396insGG)2016
RHD(449del T)RHD*01N.12CDeD negativeEurasian D clusterRHD(449del T)2004
RHD(489delAGAC)RHD*01N.13CDeD negativeEurasian D clusterRHD(487del ACAG)19981998
RHD(510insG)not reportedEurasian D clusterRHD(510insG)2015
RHD(519C>T)CDeweakened D expressionEurasian D clusterRHD(519C>T)2013
RHD(520G>A,1080_1989del)CDeD negativeEurasian D clusterRHD(520G>A,1080_1989del)20142014
RHD(53dekT)not reportedEurasian D clusterRHD(53dekT)2016
RHD(545delCTGT)RHD*01N.46cDeD negativeEurasian D clusterRHD(545delCTGT)20122012
RHD(576C>T)CDeweakened D expressionEurasian D clusterRHD(576C>T)2011
not reportedEurasian D clusterRHD(581insG)
RHD(60L,S230I)RHD*60not reportedEurasian D clusterRHD(I60L,S230I)
RHD(615delCA)RHD*01N.34CDeD negativeEurasian D clusterRHD(615delCA)20092012
RHD(652delA 653T>G)RHD*01N.17not reportedD negativeEurasian D clusterRHD(652delA 653T>G)2006
CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD(683del16)not reportedEurasian D clusterRHD(683del16)2013
not reportedD negativeEurasian D clusterRHD(697delG)
not reportedD negativeEurasian D clusterRHD(702delG)2017
RHD(711del C)RHD*01N.16cDED negativeEurasian D clusterRHD(711del C)20022002
RHD(712delG)RHD*01N.33CDeD negativeEurasian D clusterRHD(712delG)20082009
RHD(745del13)RHD*01N.47CDeD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA,758TC>AG)2008
RHD(786del A)RHD*01EL.13
CDeD negativeEurasian D clusterRHD(785del A)20042009
RHD(78delC)RHD*01N.32CDeD negativeEurasian D clusterRHD(78delC)20092010
RHD(79delCTC)not reportedEurasian D clusterRHD(79delCTC)2016
RHD(822delG)RHD*01N.48not reportedD negativeEurasian D clusterRHD(822delG)2014
RHD(843G>T)not reportedEurasian D clusterRHD(843G>T)2017
RHD(909ins TGGCT, IVS6+2del TAAG)RHD*01N.27CDeD negativeEurasian D clusterRHD(909ins TGGCT, IVS6+2del TAAG)20022002
RHD(915delC)RHD*01N.49not reportedD negativeEurasian D clusterRHD(915delC)20142014
RHD(9393A>C)not reportedEurasian D clusterRHD(IVS6+3A>C)2017
RHD(939G>C)not reportedEurasian D clusterRHD(939G>C)2017
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD(950delA)RHD*01N.51not reportedD negativeEurasian D clusterRHD(950delA)2012
RHD(970delCAC,976delTCCATCATGGGCTACA)RHD*01N.28CDeD negativeEurasian D clusterRHD(970delCAC,976delTCCATCATGGGCTACA)20082009
not reportedDELEurasian D clusterRHD(993delC)2014
CDeDELEurasian D clusterRHD(A137E)20062009
RHD(A137V,N152T)-CE(4-6)-D(7-10)not reportedDIVa clusterRHD(A137V,N152T)-CE(4-6)-D(7-10)2016
RHD(A209V)not reportedD positive (no further data)Eurasian D clusterRHD(A209V)20112012
RHD(A237D)not reportedEurasian D clusterRHD(A237D)2010
RHD(A237V)not reportedEurasian D clusterRHD(A237V)2016
RHD(A354T)RHD*50CDePartial DEurasian D clusterRHD(A354T)20142014
RHD(D164E)RHD*61not reportedPartial DEurasian D clusterRHD(D164E)
RHD(D350H)not reportedEurasian D clusterRHD(D350H)2013
RHD(D35E,A399T)not reportedweakened D expressionEurasian D clusterRHD(D35E,A399T)20162016
cDEDELEurasian D clusterRHD(D404H)2012
RHD(D40G)not reportedEurasian D clusterRHD(D40G)2016
RHD(D53Y)RHD* 01W.104
RHD*weak D type 104
not reportedweakened D expressionEurasian D clusterRHD(D53Y)2015
RHD(D95G)not reportedweakened D expressionEurasian D clusterRHD(D95G)20072007
RHD(del Ex8)RHD*01EL.30
not reportedDELEurasian D clusterRHD(del Ex8)20072007
RHD(del44L)RHD*51not reportedPartial DEurasian D clusterRHD(130delCTC)2013
RHD(delEx1)RHD*01N.67not reportedD negativeEurasian D clusterRHD(2-10)
RHD(E146D)not reportedweakened D expressionEurasian D clusterRHD(E146D)2011
RHD(E146K)not reportedweakened D expressionEurasian D clusterRHD(E146K)2012
RHD(E340G)not reportedEurasian D clusterRHD(E340G)2013
RHD(F161C)CDeweakened D expressionEurasian D clusterRHD(F161C)2015
RHD(F175L)RHD*59not reportedPartial DEurasian D clusterRHD(F175L)
RHD(F179L)CDeD positive (no further data)Eurasian D clusterRHD(F179L)2012
RHD(F179S)not reportedEurasian D clusterRHD(F179S)2012
RHD(F223V,G278V)not reportedD positive (no further data)weak D type 4 clusterRHD(F223V,G278V)20122012
RHD(F223V,K267M)not reportedweak D type 4 clusterRHD(F223V,K267M)2017
RHD(F31L)CDeDELEurasian D clusterRHD(F31L)20142014
RHD(G180R)not reportedD positive (no further data)Eurasian D clusterRHD(G180R)20112012
cDeDELEurasian D clusterRHD(G212R)20082009
RHD(G212V)RHD*01N.15CDeD negativeEurasian D clusterRHD(G212V)20012001
RHD(G255R)not reportedEurasian D clusterRHD(G255R)2012
RHD(G263L,T379M)not reportedDAU clusterRHD(G263L,T379M)2017
RHD(G263R,A399T)not reportedEurasian D clusterRHD(G263R,A399T)2016
RHD(G307R)not reportedEurasian D clusterRHD(G307R)2016
RHD(G308R)not reportedEurasian D clusterRHD(G308R)2017
CDeD negativeEurasian D clusterRHD(G308X)2010
RHD(G314V)RHD*01N.20CDeD negativeEurasian D clusterRHD(G314V)19971997
not reportedD negativeEurasian D clusterRHD(G336D)2011
RHD(G353W,A354N)not reportedD positive (no further data)Eurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20122012
RHD(G368R)not reportedEurasian D clusterRHD(G368R)2014
RHD(G368W,D404E)not reportedEurasian D clusterRHD(G368W,D404E)2015
RHD(G381R)not reportedEurasian D clusterRHD(G381R)2017
RHD(G385D)RHD*01N.53not reportedD negativeEurasian D clusterRHD(G385D)20142014
RHD(G385V)not reportedEurasian D clusterRHD(G385V)2016
RHD(G96D)RHD* 01W.108
RHD*weak D type 108
not reportedweakened D expressionEurasian D clusterRHD(G96D)20152015
RHD(G96R)not reportedEurasian D clusterRHD(G96R)2016
RHD(G96S)CDeweakened D expressionEurasian D clusterRHD(G96S)2005
RHD(H166D)not reportedEurasian D clusterRHD(H166D)2016
RHD(H171D)CDeD positive (no further data)Eurasian D clusterRHD(H171D)2012
RHD(H260R)not reportedweakened D expressionEurasian D clusterRHD(H260R)2013
RHD(H397R)not reportedD positive (no further data)Eurasian D clusterRHD(H397R)20112012
RHD(H72P,S73C)not reportedEurasian D clusterRHD(H72P,S73C)2016
RHD(I341N)not reportedweakened D expressionEurasian D clusterRHD(I341N)2016
RHD(I392T)not reportedD positive (no further data)Eurasian D clusterRHD(I392T)20112012
RHD(I60L)not reportedEurasian D clusterRHD(I60L)2016
RHD(I60L,S68N,K198N,F223V,G314V,I342T)not reportedweak D type
weakened D expression
weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,G314V,I342T)2010
RHD(I60V,S103P,F161S,L214F)not reportedEurasian D clusterRHD(I60V,S103P,F161S,L214F)2012
not reportedDELEurasian D clusterRHD(IVS1+1G>A)2001
cDEDELEurasian D clusterRHD(1481G>T)20142014
not reportedDELEurasian D clusterRHD(IVS1+5G>C)2013
CDeDELEurasian D clusterRHD(IVS1-29G>C)2012
RHD(IVS2+1G>A)RHD*01N.24not reportedD negativeEurasian D clusterRHD(IVS2+1G>A)20072007
RHD(IVS2-1G>A)RHD*01N.25CDeD negativeEurasian D clusterRHD(IVS2-1G>A)20052005
not reportedDELEurasian D clusterRHD(IVS2-2A>G)20112011
not reportedDEL
Partial D
Eurasian D clusterRHD(IVS2-2delA)2013
D negative
Eurasian D clusterRHD(IVS3+1G>A)20012001
cDED negativeEurasian D clusterRHD(IVS3+2T>A)20082009
RHD(IVS3+5G>A)not reportedweakened D expressionEurasian D clusterRHD(IVS3+5G>A)20072007
RHD(IVS4+1G>A)not reportedEurasian D clusterRHD(IVS4+1G>A)2012
RHD(IVS4+1G>T,1136C>T)RHD*01N.69not reportedD negativeDAU clusterRHD(IVS4+1G>T,1136C>T)
RHD(IVS4+2T>A)not reportedEurasian D clusterRHD(IVS4+2T>A)2012
not reportedweakened D expressionEurasian D clusterRHD(IVS4+5G>T)2010
RHD(IVS4-2A>C)RHD*54cDEPartial DEurasian D clusterRHD(IVS4-2A>C)20142014
not reportedweakened D expressionEurasian D clusterRHD(IVS4-2A>G)20102011
RHD(IVS5+1G>A)RHD*01N.54not reportedD negativeEurasian D clusterRHD(IVS5+1G>A)2012
RHD(IVS5+2T>A)not reportedEurasian D clusterRHD(IVS5+2T>A)2012
RHD(IVS5-38del tctc)RHD*01N.58not reportedDELEurasian D clusterRHD(IVS5-38del tctc)20052005
RHD(IVS5-41delCTCT)not reportedEurasian D clusterRHD(IVS5-41delCTCT)2012
RHD(IVS6+1G>A)RHD*01N.55CDeD negativeEurasian D clusterRHD(IVS6+1G>A)20142014
RHD(IVS6+2T>A)RHD*01N.38not reportedD negativeEurasian D clusterRHD(IVS6+2T>A)2013
RHD(IVS6-4A>C)not reportedweakened D expressionEurasian D clusterRHD(IVS6-4A>C)2012
CDeDELEurasian D clusterRHD(IVS7+152C>A,1227G>A)20022002
RHD(IVS7+1G>A)not reportedEurasian D clusterRHD(IVS7+1G>A)2016
RHD(IVS7+1G>T)RHD*01N.70not reportedD negativeEurasian D clusterRHD(IVS7+1G>T)
RHD(IVS7+2T>C)RHD*01N.56not reportedD negativeEurasian D clusterRHD(IVS7+2T>C)2012
RHD(IVS7-1G>A)RHD*01N.71not reportedEurasian D clusterRHD(IVS7-1G>A)
not reportedEurasian D clusterRHD(IVS7-2A>C)2011
RHD(IVS8+1G>A)RHD*01N.26CDeD negativeEurasian D clusterRHD(IVS8+1G>A)20012001
RHD(IVS8+6T>C)cDEweakened D expressionEurasian D clusterRHD(IVS8+6T>C)2012
not reportedDELEurasian D clusterRHD(IVS8-31C>T)2012
not reportedweakened D expressionEurasian D clusterRHD(IVS8-8T>A)20072007
CDeEurasian D clusterRHD(IVS9-1G>A)20142014
RHD(K133N)not reportedweakened D expressionEurasian D clusterRHD(K133N)2014
RHD(K189N,S257F)not reportedEurasian D clusterRHD(K189N,S257F)2016
RHD(K235N)not reportedEurasian D clusterRHD(K235N)2017
RHD(K267M)not reportedEurasian D clusterRHD(K267M)2016
RHD(L110P)-CE(3-9)-DCDeEurasian D clusterRHD(L110P)-CE(3-9)-D20142014
cDEDELEurasian D clusterRHD(L153P)20042009
not reportedDELEurasian D clusterRHD(L18P)20062006
RHD(L20P)not reportedEurasian D clusterRHD(L20P)2017
RHD(L258S)not reportedEurasian D clusterRHD(L258S)2017
RHD(L297P)not reportedEurasian D clusterRHD(L297P)2016
not reportedEurasian D clusterRHD(L299P)2011
CDeD negative
Eurasian D clusterRHD(L337R)20142014
RHD(L370L)CDeweakened D expressionEurasian D clusterRHD(L370L)2009
RHD(L386X)not reportedD negativeEurasian D clusterRHD(L386X)20142014
not reportedDELEurasian D clusterRHD(L38X)2010
RHD(L390L)not reportedweakened D expressionEurasian D clusterRHD(L390L)20102011
RHD(L81P)RHD*55not reportedweakened D expression
Partial D
Eurasian D clusterRHD(L81P)2009
not reportedDELEurasian D clusterRHD(L84P)20062006
CDeDELEurasian D clusterRHD(L93R)20142014
RHD(M155V)not reportedEurasian D clusterRHD(M155V)2017
not reportedDELEurasian D clusterRHD(M1I)20062006
RHD(M1T)cDEEurasian D clusterRHD(M1T)20152015
not reportedDAU clusterRHD(M1V,T379M)2008
RHD(M218I, F223V, S225F,Y269X)not reportedD negativeweak D type 4 clusterRHD(609G>A,654G>C,667T>G,674C>T,807T>G)2009
RHD*weak partial 11
Partial D
Eurasian D clusterRHD(M295I)20012001
RHD(N135D)not reportedEurasian D clusterRHD(N135D)2014
RHD(N152T,V270G)RHD*62not reportedEurasian D clusterRHD(N152T,V270G)2014
RHD(N224D)not reportedweakened D expressionEurasian D clusterRHD(N224D)2013
RHD(N240H)not reportedEurasian D clusterRHD(N240H)2014
RHD(P221R)not reportedEurasian D clusterRHD(P221R)2016
RHD(P231L)not reportedEurasian D clusterRHD(P231L)2016
RHD(P261A)not reportedweakened D expressionEurasian D clusterRHD(P261A)2017
CDeDELEurasian D clusterRHD(P291R)2012
RHD(P313T)CDeweakened D expressionEurasian D clusterRHD(P313T)2015
RHD(Q200X)RHD*01N.59not reportedD negativeEurasian D clusterRHD(Q200X)2011
RHD(Q362X)RHD*01N.64not reportedD negativeEurasian D clusterRHD(Q362X)
RHD(Q405X)RHD*01N.60not reportedD negativeEurasian D clusterRHD(Q405X)2015
RHD(Q41X)RHD*01N.09CDeD negativeEurasian D clusterRHD(Q41X)19971997
RHD(Q49R)not reportedweakened D expressionEurasian D clusterRHD(Q49R)2003
RHD(Q89R)not reportedEurasian D clusterRHD(Q89R)2014
RHD(R10L)not reportedEurasian D clusterRHD(R10L)2015
RHD(R114Q,A399T)not reportedEurasian D clusterRHD(R114Q,A399T)2017
RHD(R318X)RHD*01N.61CDeD negativeEurasian D clusterRHD(R318X)20082009
RHD(R71S)not reportedD positive (no further data)Eurasian D clusterRHD(R71S)20112012
RHD(S103P)RHD*39cDEPartial DEurasian D clusterRHD(S103P)19961996
RHD(S112G)not reportedweakened D expressionEurasian D clusterRHD(S112G)2009
RHD(S112I)RHD*01N.68not reportedEurasian D clusterRHD(S112I)2012
not reportedDELEurasian D clusterRHD(S112T)2012
RHD(S122W)not reportedD positive (no further data)Eurasian D clusterRHD(S122W)20112012
RHD(S230I)not reportedEurasian D clusterRHD(S230I)2016
RHD(S230N)not reportedEurasian D clusterRHD(S230N)2016
RHD(S254L,T379M)not reportedDAU clusterRHD(S254L,T379M)2017
RHD(S254X)RHD*01N.62CDeD negativeEurasian D clusterRHD(S254X)20152015
RHD(S256X)RHD*01N.39CDeD negativeEurasian D clusterRHD(S256X)20122013
RHD(S266G,V270G)not reportedEurasian D clusterRHD(S266G,V270G)2016
RHD(S68T)-RHCe(3-9)-RHDRHD*01N.04CDeD negativeEurasian D clusterRHD(S68T)-RHCE(3-9)-RHD20052005
not reportedD negativeEurasian D clusterRHD(T148R)2012
RHD(T148R,T195M)not reportedEurasian D clusterRHD(T148R,T195M)2017
RHD(T201R,F223V,G307R)not reportedD positive (no further data)weak D type 4 clusterRHD(T201R,F223V,G307R)20122012
RHD(T201R,F223V,K264N,A273A)not reportedweak D type 4 clusterRHD(T201R,F223V,K264N,A273A)2016
RHD(T201R,V270G)not reportedEurasian D clusterRHD(T201R,V270G)2017
not reportedEurasian D clusterRHD(T241P)
RHD(T32N)not reportedweakened D expressionEurasian D clusterRHD(T32N)2013
RHD(V147M,A399T)not reportedEurasian D clusterRHD(V147M,A399T)2016
RHD(V174M,G307R)not reportedEurasian D clusterRHD(V174M,G307R)2017
RHD(V174M,V306I)cDeEurasian D clusterRHD(V174M,V306I)2012
RHD(V238L,V270G)not reportedD positive (no further data)Eurasian D clusterRHD(V238L,V270G)20122012
RHD(V245L,G263R,K267M)not reportedEurasian D clusterRHD(V245L,G263R,K267M)2017
RHD(V247L)not reportedEurasian D clusterRHD(V247L)2017
RHD(V281L)not reportedEurasian D clusterRHD(V281L)2016
RHD(V306I,Y311C)not reportedEurasian D clusterRHD(V306I,Y311C)2016
RHD(V319G)not reportedEurasian D clusterRHD(V319G)2017
RHD(V50D)not reportedEurasian D clusterRHD(V50D)2016
RHD(V56M,W90X)CDeD negative
D negative
Eurasian D clusterRHD(V56M,W90X)20082009
cDEDELEurasian D clusterRHD(W16R)2012
RHD(W16X)RHD*01N.08CDeD negativeEurasian D clusterRHD(W16X)20012001
RHD(W185X)RHD*01N.14CDeD negativeEurasian D clusterRHD(W185X)20052005
not reportedEurasian D clusterRHD(W393X)20142014
CDeDELEurasian D clusterRHD(W408R)20052005
RHD(W90X)RHD*01N.10CDeD negativeEurasian D clusterRHD(W90X)20022002
CDeDELEurasian D clusterRHD(X418L)20052005
RHD(X418S)not reportedEurasian D clusterRHD(X418S)2014
RHD(Y243X)not reportedEurasian D clusterRHD(Y243X)2017
RHD(Y269X)RHD*01N.18CDeD negativeEurasian D clusterRHD(Y269X)20042009
RHD(Y311X)[761G]RHD*01N.63not reportedD negativeEurasian D clusterRHD(Y311X)
RHD(Y311X)[933A]RHD*01N.19CDeD negativeEurasian D clusterRHD(Y311X)20052005
RHD(Y330X)RHD*01N.21CDeD negativeEurasian D clusterRHD(Y330X)20012001
RHD(Y343X)RHD*01N.40cDED negativeEurasian D clusterRHD(Y343X)20122013
RHD(Y34C)not reportedweakened D expressionEurasian D clusterRHD(Y34C)2011
cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD(Y48C)not reportedweakened D expressionEurasian D clusterRHD(Y48C)20162016
RHD*5'UTR-115Cnot reportedEurasian D clusterRHD(1-115A>C)2017
RHD*745_757delRHD*01N.30not reportedD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA)
RHD-CE(2-7)-D1see Ccdes-1
RHD-CE(2-7)-D2see Ccdes-1
RHD-cE(5-6)-Dnot reportedEurasian D clusterRHD-cE(5-6)-D2015
RHD-ceAG.05(2)-Dnot reportedEurasian D clusterRHD-RHCE(2)-RHD(A85G)2017
RHD-RHCE(10)CDeDELEurasian D clusterRHD-RHCE(10)20092009
RHD-RHCE(2-10)CdeD negativeno RHDRHD-RHCE(2-10)20042004
RHD-RHCE(2-5)-RHDnot reportedDELEurasian D clusterRHD-RHCE(2-5)-RHD
RHD-RHCe(2-7)-RHDRHD*01N.05CDeD negativeEurasian D clusterRHD-RHCE(3-7)-RHD20012001
RHD-RHCe(2-8)-RHDsee Ccdes-1
RHD-RHCe(2-9)-RHDRHD*01N.03CDeD negativeEurasian D clusterRHD-RHCe(2-9)-RHD19961996
RHD-RHCE(3)--weak D type 4.0RHD*01N.72not reportedD negativeweak D type 4 clusterRHD-RHCE(3)-RHD(T201R,F223V,819G>A)
RHD-RHCE(4-7)-RHDRHD*01N.07cDED negative
Eurasian D clusterRHD-RHCE(4-7)-RHD19961996
RHD-RHCE(4-7)-RHD1RHD*01N.07cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD-RHCE(4-7)-RHD2RHD*01N.07cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD-RHCE(4-8)-RHDRHD*01N.07CDeD negativeEurasian D clusterRHD-RHCE(4-7)-RHD20052005
CDeDELEurasian D clusterRHD-RHCE(4-9)-RHD20092009
RHD-RHCE(5:733-5:787)-RHDnot reportedEurasian D clusterRHD-RHCE(5:733-5:787)-RHD2016
D category
Eurasian D clusterRHD-RHCE(7)-RHD2012
RHD-RHCE(8-9)-RHDCDeD negativeEurasian D clusterRHD-RHCE(8-9)-RHD19971997
RHD-RHcE[226P](5:676-5:733)-RHDnot reportedEurasian D clusterRHD-RHcE[226P](5:676-5:733)-RHD2016
RHD-RHCE[245V](5)-RHDnot reportedEurasian D clusterRHD-RHCE[245V](5)-RHD2017
RHDex10del type 1not reportedweakened D expression
Eurasian D clusterRHD(1227+2874_1254+1317del)20122012
RHDex10del type 2not reportedD negativeEurasian D clusterRHD(del1227-2108_1254+1317)20172017
RHDex1del type 1cDeDELEurasian D clusterRHD(c.1-15144_148+3158deldel)20172017
RHDpsi-OT1cDeweak D type 4 cluster2012
standard RHDRHD*01multipleD positive (apparently normal)Eurasian D clusterRHD
weak D type 1RHD*01W.1
RHD*weak D type 1
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V270G)19991999
weak D type 1.1RHD*01W.1.1
RHD*weak D type 1.1
CDeweak D type
weakened D expression
Eurasian D clusterRHD(L18V,V270G)20042005
weak D type 1.2RHD*01w.1.2
RHD*weak D type 1.2
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V238M,V270G)20142014
weak D type 10RHD*01W.10
RHD*weak D type 10
cDEweak D type
weakened D expression
Eurasian D clusterRHD(W393R)19991999
weak D type 10.1RHD*01W.10.1
RHD*weak D type 10.1
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P,W393R)2016
weak D type 10.2RHD*01W.10.2
RHD*weak D type 10.2
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(W393R,K400T)20152016
weak D type 100RHD* 01W.100
RHD*weak D type 100
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G263R)2010
weak D type 101RHD* 01W.101
RHD*weak D type 101
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(E21A)2015
weak D type 102RHD* 01W.102
RHD*weak D type 102
multipleweakened D expression
weak D type
Eurasian D clusterRHD(I25F)2016
weak D type 103RHD* 01W.103
RHD*weak D type 103
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F31I)2015
weak D type 105RHD* 01W.105
RHD*weak D type 105
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S67W)20152015
weak D type 106RHD* 01W.106
RHD*weak D type 106
cDEweak D type
weakened D expression
Eurasian D clusterRHD(W74G)20152015
weak D type 107RHD* 01W.107
RHD*weak D type 107
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S75C)2015
weak D type 109RHD* 01W.109
RHD*weak D type 109
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S126P)2015
weak D type 11RHD*11
RHD*weak partial 11
cDeweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(M295I)19991999
weak D type 110RHD* 01W.110
RHD*weak D type 110
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(Q138R)20152015
weak D type 111RHD* 01W.111
RHD*weak D type 111
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212S)2015
weak D type 112RHD* 01W.112
RHD*weak D type 112
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212D)20152015
weak D type 113RHD* 01W.113
RHD*weak D type 113
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(W292R)2015
weak D type 114RHD* 01W.114
RHD*weak D type 114
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(P323L)20152015
weak D type 115RHD* 01W.115
RHD*weak D type 115
CDeweakened D expression
weak D type
Eurasian D clusterRHD(M328K)20152015
weak D type 116RHD* 01W.116
RHD*weak D type 116
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116P)20152015
weak D type 117RHD* 01W.117
RHD*weak D type 117
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116T)2015
weak D type 118RHD* 01W.118
RHD*weak D type 118
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116V)2010
weak D type 119RHD* 01W.119
RHD*weak D type 119
CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273V)2010
weak D type 12RHD*01W.12
RHD*weak D type 12
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G277E)19991999
weak D type 120RHD* 01W.120
RHD*weak D type 120
CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273E)2010
weak D type 121RHD* 01W.121
RHD*weak D type 121
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A59D)2015
weak D type 122RHD* 01W.122
RHD*weak D type 122
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(R70W)2011
weak D type 123RHD* 01W.123
RHD*weak D type 123
not reportedweakened D expression
weakened D expression
Eurasian D clusterRHD(V127L)2015
weak D type 124RHD* 01W.124
RHD*weak D type 124
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K198N)2015
weak D type 125RHD* 01W.125
RHD*weak D type 125
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(N224S)2015
weak D type 126RHD* 01W.126
RHD*weak D type 126
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K400I)2015
weak D type 127RHD* 01W.127
RHD*weak D type 127
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K400N)2012
weak D type 128RHD* 01W.128
RHD*weak D type 128
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(D403Y)2015
weak D type 129RHD* 01W.129
RHD*weak D type 129
CDeweakened D expression
weak D type
Eurasian D clusterRHD(D403V)20122012
weak D type 13RHD*01W.13
RHD*weak D type 13
CDeweak D type
weakened D expression
Eurasian D clusterRHD(A276P)19991999
weak D type 130RHD* 01W.130
RHD*weak D type 130
CDeweakened D expression
weak D type
Eurasian D clusterRHD(T55P)20112012
weak D type 131RHD* 01W.131
RHD*weak D type 131
CDeweakened D expression
weak D type
Eurasian D clusterRHD(A85G)20122012
weak D type 132RHD* 01W.132
RHD*weak D type 132
CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132R)20102012
weak D type 132.0.1not reportedweak D typeEurasian D clusterRHD(G132R)2016
weak D type 133RHD* 01W.133
RHD*weak D type 133
CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132E)20122012
weak D type 134RHD* 01W.134
RHD*weak D type 134
not reportedweak D typeEurasian D clusterRHD(L390V)2012
weak D type 135RHD* 01W.135
RHD*weak D type 135
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(M295K)2016
weak D type 136RHD* 01W.136
RHD*weak D type 136
not reportedweak D typeEurasian D clusterRHD(P14L)2016
weak D type 137RHD* 01W.137
RHD*weak D type 137
not reported
weak D type
Eurasian D clusterRHD(H260Q)2016
weak D type 138RHD* 01W.138
RHD*weak D type 138
not reportedweak D typeEurasian D clusterRHD(P291S)2016
weak D type 139RHD* 01W.139
RHD*weak D type 139
not reported
weak D type
Eurasian D clusterRHD(L390P)2016
weak D type 14RHD*01W.14
RHD*weak D type 14
cDEweak D type
weakened D expression
Eurasian D clusterRHD(S182T,K198N,T201R)19991999
weak D type 140RHD* 01W.140
RHD*weak D type 140
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F410S)20162016
weak D type 141RHD*52
RHD* 01W.141
cDePartial D
weakened D expression
weak D type
Eurasian D clusterRHD(F223S)20152016
weak D type 142RHD* 01W.142
RHD*weak D type 142
CDeweakened D expression
weak D type
Eurasian D clusterRHD(A23S)2016
weak D type 143RHD* 01W.143
RHD*weak D type 143
CDeweakened D expression
weak D type
Eurasian D clusterRHD(A58V)2015
weak D type 144RHD* 01W.144
RHD*weak D type 144
CDeweakened D expression
weak D type
Eurasian D clusterRHD(E193D)2016
weak D type 145RHD* 01W.145
RHD*weak D type 145
not reportedEurasian D clusterRHD(P14R)
weak D type 15RHD*15
RHD*weak partial 15
cDEweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(G282D)19991999
weak D type 16RHD*01W.16
RHD*weak D type 16
cDEweak D type
weakened D expression
Eurasian D clusterRHD(W220R)19991999
weak D type 17RHD*01W.17
RHD*weak D type 17
CDEweak D type
weakened D expression
Eurasian D clusterRHD(R114W)20002000
weak D type 18RHD*01W.18
RHD*weak D type 18
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R7W)2000
weak D type 19RHD*01W.19
RHD*weak D type 19
cDeweak D type
weakened D expression
Eurasian D clusterRHD(I204T)20062006
weak D type 2RHD*01W.2
RHD*weak D type 2
cDEweak D type
weakened D expression
Eurasian D clusterRHD(G385A)19991999
weak D type 2.1RHD*01W.2.1
RHD*weak D type 2.1
cDEweak D type
weakened D expression
Eurasian D clusterRHD(F101I,G385A)2009
weak D type 2.2RHD*01W.2.2
RHD*weak D type 2.2
cDEweak D type
weakened D expression
Eurasian D clusterRHD(V306I,Y311C,G385A)20142014
weak D type 20RHD*01W.20
RHD*weak D type 20
cDEweak D typeEurasian D clusterRHD(F417S)20002006
weak D type 21RHD*21
RHD*weak partial D 21
CDeweak D type
Partial D
weakened D expression
Eurasian D clusterRHD(P313L)20012001
weak D type 22RHD*01W.22
RHD*weak D type 22
CDeweak D type
weakened D expression
Eurasian D clusterRHD(W408C)2000
weak D type 23RHD*01W.23
RHD*weak D type 23
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G212C)20012001
weak D type 24RHD*01W.24
RHD*weak D type 24
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L338P)20032003
weak D type 25RHD*01W.25
RHD*weak D type 25
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114Q)2005
weak D type 26RHD*01W.26
RHD*weak D type 26
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V9D)20042005
weak D type 27RHD*01W.27
RHD*weak D type 27
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221S)2002
weak D type 28RHD*01W.28
RHD*weak D type 28
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(1152A>C)2002
weak D type 29RHD*01W.29
RHD*weak D type 29
cDeweak D type
weakened D expression
weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,I342T)20032003
weak D type 3RHD*01W.3
RHD*weak D type 3
CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C)19991999
weak D type 3.1RHD*01W.3.1
RHD*weak D type 3.1
CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C,I60L)20142014
weak D type 30RHD*01W.30
RHD*weak D type 30
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E340M)2003
weak D type 31RHD*01W.31
RHD*weak D type 31
CDeweak D type
weakened D expression
Eurasian D clusterRHD(P6L)20042005
weak D type 32RHD*01W.32
RHD*weak D type 32
CDeweak D type
weakened D expression
Eurasian D clusterRHD(I374N)20052005
weak D type 33RHD*01W.33
RHD*weak D type 33
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V174M)20032003
weak D type 34RHD*01W.34
RHD*weak D type 34
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V270E)20032003
weak D type 35RHD*01W.35
RHD*weak D type 35
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G87D)2003
weak D type 36RHD*01W.36
RHD*weak D type 36
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V281G)2004
weak D type 37RHD*01W.37
RHD*weak D type 37
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K133N)20032004
weak D type 38RHD*01W.38
RHD*weak D type 38
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G278D)20032004
weak D type 39RHD*01W.39
RHD*weak D type 39
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339R)2003
weak D type 4.0RHD*09.03.01
cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)[819G>A]19991999
weak D type 4.0.1RHD*09.03
cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)
weak D type 4.1RHD*09.04
cDeweak D type
weakened D expression
weak D type 4 clusterRHD(W16C,T201R,F223V)20002000
weak D type 4.2.1 (DAR1.1)RHD*09.01.01
RHD*weak 4.2
cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
weak D type 4.2.2 (DAR1.2)RHD*09.01.02
cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C>T,957G>A]20002000
weak D type 4.2.3 (DAR1.3)RHD*09.01.03
cDeweak D type
Partial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C]2008
weak D type 4.3RHD*09. 05
RHD*weak 4.3
cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V,P291R)[819G>A]2004
weak D type 4.4not reportedweak D typeweak D type 4 clusterRHD(K198N,T201R,F223V)2016
weak D type 4.5not reportedweak D typeweak D type 4 clusterRHD(T201R,F223V,G355S)2016
weak D type 40RHD*01W.40
RHD*weak D type 40
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(T201R)2003
weak D type 41RHD*01W.41
RHD*weak D type 41
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398V)2004
weak D type 41.0.1RHD*01w.41.0.1
RHD*weak D type 41.01.
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L390L,E398V)2016
weak D type 42RHD*01W.42
RHD*weak D type 42
not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(K409M)20052005
weak D type 43RHD*01W.43
RHD*weak D type 43
CDeweak D type
weakened D expression
Eurasian D clusterRHD(A202V)20062006
weak D type 44RHD*01W.44
RHD*weak D type 44
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243C)2004
weak D type 45RHD*01W.45
RHD*weak D type 45
not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(A399T)2004
weak D type 45.1RHD*01w.45.1
RHDÜweak D type 45.1
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A273V,A399T)2010
weak D type 45.2RHD*01w.45.2
RHDÜweak D type 45.2
CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70W,A273V,A399T)20132013
weak D type 46RHD*01W.46
RHD*weak D type 46
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F407L)2004
weak D type 47RHD*01W.47
RHD*weak D type 47
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114G)2005
weak D type 48RHD*01W.48
RHD*weak D type 48
cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61V)2005
weak D type 49RHD*01W.49
RHD*weak D type 49
CDeweak D type
weakened D expression
Eurasian D clusterRHD(S257F)20062007
weak D type 5RHD*01W.5
RHD*weak D type 5
cDEweak D type
weakened D expression
Eurasian D clusterRHD(A149D)19991999
weak D type 50RHD*01W.50
RHD*weak D type 50
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243N)2006
weak D type 51RHD*01W.51
RHD*weak D type 51
not reportedweak D type
weakened D expression
Eurasian D clusterRHD-RHCE(4:594-4:602)-RHD2005
weak D type 52RHD*01W.52
RHD*weak D type 52
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F31S)2005
weak D type 53RHD*01W.53
RHD*weak D type 53
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V247G)2005
weak D type 54RHD*01W.54
RHD*weak D type 54
cDEweak D type
weakened D expression
Eurasian D clusterRHD(S122L)
weak D type 55RHD*01W.55
RHD*weak D type 55
cDEweak D type
weakened D expression
Eurasian D clusterRHD(L299V)2007
weak D type 56RHD*01W.56
RHD*weak D type 56
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A22E)20072007
weak D type 57RHD*57
RHD*weak partial 57
not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(L214F)20072007
weak D type 58RHD*01W.58
RHD*weak D type 58
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G336R)20072007
weak D type 59RHD*01W.59
RHD*weak D type 59
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L383P)20072007
weak D type 6RHD*01W.6
RHD*weak D type 6
CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10Q)19991999
weak D type 60RHD*01W.60
RHD*weak D type 60
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(407delFW)20072007
weak D type 61RHD*01W.61
RHD*weak D type 61
CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10W)20062006
weak D type 62RHD*01W.62
RHD*weak D type 62
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221T)2006
weak D type 63RHD*01W.63
RHD*weak D type 63
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I253N)2007
weak D type 64RHD*01W.64
RHD*weak D type 64
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A294V)2007
weak D type 65RHD*01W.65
RHD*weak D type 65
cDeweak D type
weakened D expression
Eurasian D clusterRHD(A23D)2008
weak D type 66RHD*01W.66
RHD*weak D type 66
CDeweak D type
weakened D expression
Eurasian D clusterRHD(V306I)2007
weak D type 67RHD*01W.67
RHD*weak D type 67
cDEweak D type
weakened D expression
Eurasian D clusterRHD(T241I)2008
weak D type 68RHD*01W.68
RHD*weak D type 68
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(165C>T,1213C>G)2006
weak D type 69RHD*01W.69
RHD*weak D type 69
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R318Q)2008
weak D type 7RHD*01W.7
RHD*weak D type 7
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339E)19991999
weak D type 70RHD*01W.70
RHD*weak D type 70
CDeweak D type
weakened D expression
Eurasian D clusterRHD(L338V)2008
weak D type 71RHD*01W.71
RHD*weak D type 71
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R10P)2009
weak D type 72RHD*01W.72
RHD*weak D type 72
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(D404E)2007
weak D type 73RHD* 01W.73
RHD*weak D type 73
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A414V)2009
weak D type 74RHD* 01W.74
RHD*weak D type 74
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
weak D type 75RHD* 01W.75
RHD*weak D type 75
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398D)2010
weak D type 76RHD* 01W.76
RHD*weak D type 76
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Q405H)2010
weak D type 77RHD* 01W.77
RHD*weak D type 77
not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S256P)20102011
weak D type 78RHD* 01W.78
RHD*weak D type 78
CDeweakened D expression
weak D type
Eurasian D clusterRHD(F410V)20092011
weak D type 79RHD* 01W.79
RHD*weak D type 79
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L187P)2012
weak D type 8RHD*01W.8
RHD*weak D type 8
CDeweak D type
weakened D expression
Eurasian D clusterRHD(G307R)19991999
weak D type 80RHD* 01W.80
RHD*weak D type 80
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G180E)2012
weak D type 81RHD* 01W.81
RHD*weak D type 81
CDeweak D type
weakened D expression
Eurasian D clusterRHD(K400T)2012
weak D type 82RHD* 01W.82
RHD*weak D type 82
CDeweak D type
weakened D expression
Eurasian D clusterRHD(A395V)2012
weak D type 83RHD* 01W.83
RHD*weak D type 83
cDEweakened D expressionEurasian D clusterRHD(L413W)2012
weak D type 84RHD* 01W.84
RHD*weak D type 84
CDeweak D type
weakened D expression
Eurasian D clusterRHD(S76N)2013
weak D type 85RHD* 01W.85
RHD*weak D type 85
CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70Q)2010
weak D type 86RHD* 01W.86
RHD*weak D type 86
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V345E)2014
weak D type 87RHD* 01W.87
RHD*weak D type 87
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I125N)20142015
weak D type 88RHD* 01W.88
RHD*weak D type 88
cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61A)2014
weak D type 89RHD* 01W.89
RHD*weak D type 89
CDeweak D type
weakened D expression
Eurasian D clusterRHD(A23P)20142014
weak D type 9RHD*01W.9
RHD*weak D type 9
cDEweak D type
weakened D expression
Eurasian D clusterRHD(A294P)19991999
weak D type 90RHD* 01W.90
RHD*weak D type 90
CDeweak D type
weakened D expression
Eurasian D clusterRHD(N331K)20142014
weak D type 91RHD* 01W.91
RHD*weak D type 91
CDeweak D type
weakened D expression
Eurasian D clusterRHD(P396R)20142014
weak D type 92RHD* 01W.92
RHD*weak D type 92
not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P)20142014
weak D type 93RHD* 01W.93
RHD*weak D type 93
cDEweak D type
weakened D expression
Eurasian D clusterRHD(A120D)2016
weak D type 94RHD* 01W.94
RHD*weak D type 94
CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
weak D type 95RHD* 01W.95
RHD*weak D type 95
cDEweak D type
weakened D expression
Eurasian D clusterRHD(A244P)20132013
weak D type 96RHD* 01W.96
RHD*weak D type 96
cDeweak D type
weakened D expression
Eurasian D clusterRHD(A244V)20132013
weak D type 97RHD* 01W.97
RHD*weak D type 97
CDeweak D type
weakened D expression
Eurasian D clusterRHD(L181P)20132013
weak D type 98RHD* 01W.98
RHD*weak D type 98
cDEweak D type
weakened D expression
Eurasian D clusterRHD(T251P)20132013
weak D type 99RHD* 01W.99
RHD*weak D type 99
CDeweak D type
weakened D expression
Eurasian D clusterRHD(E369D)20132013
weak RHD(6345G>A)CDeweakened D expressionEurasian D clusterRHD(6345G>A)2009
weak RHD(960G>A)CDeweakened D expressionEurasian D clusterRHD(960G>A)20072015
weak RHD(IVS3+3G>C)not reportedweakened D expressionEurasian D clusterRHD(IVS3+3G>C)2008
weak RHD(IVS6-14delTAA)not reportedweakened D expressionEurasian D clusterRHD(IVS6-14delTAA)2008