RHD(S225F)
674C>T (S225F)
No designation assigned
c.674 C>T
Ser to Phe at codon 225
S225F
not reported
Eurasian D cluster
First submission to GenBank: 2002 AF510070 (submitted 2002-05-08, released 2002-11-27)
First full publication: 2002 Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.
No data (found in trans to other RHD allele) Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.
Afro-Caribbean: Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.
DTO [RHD(F223V,S225F)]
RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
RHD(M218I, F223V, S225F) [RHD(IVS3-19dup37,609G>A,654G>C,667T>G,674C>T)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]
RHDpsi-OT1 []
Last update: 2012-03-25 (yyyy-MM-dd)