D674

Structure

RHD(S225F)

Key changes from standard allele

674C>T (S225F)

ISBT allele designation

No designation assigned

Nucleotide changes relative to "standard RHD"

c.674 C>T

Amino acid changes relative to standard protein

Ser to Phe at codon 225

S225F

Haplotype (typical)

not reported

Allele cluster

Eurasian D cluster

Descriptions

First submission to GenBank: 2002 AF510070 (submitted 2002-05-08, released 2002-11-27)

First full publication: 2002 Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.

ISBT group

Phenotype characterization and grouping

Serology

No data (found in trans to other RHD allele) Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.

Observations

Afro-Caribbean: Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.

Related Alleles

DTO [RHD(F223V,S225F)]
RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
RHD(M218I, F223V, S225F) [RHD(IVS3-19dup37,609G>A,654G>C,667T>G,674C>T)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]
RHDpsi-OT1 []

Additional comments

Last update: 2012-03-25 (yyyy-MM-dd)