RHD(297del23)

Structure

RHD(297del23)

Key changes from standard allele

297del23

ISBT allele designation

RHD*01N.37

Nucleotide changes relative to "standard RHD"

297 del23

Amino acid changes relative to standard protein

not applicable

Haplotype (typical)

not reported

Allele cluster

Eurasian D cluster

Descriptions

First submission to GenBank: 2013 KC290447 (submitted 2012-12-05, released 2013-01-15)

ISBT group

RHD negative

Phenotype characterization and grouping

D negative

Serology

no DEL phenotype detected using monoclonal MCAD6 anti-D KC290447

Observations

No data

Additional comments

ISBT full name RHD*297_319del CCAGTTCCCTTCTGGGAAGGTGG

Last update: 2017-06-06 (yyyy-MM-dd)