DTO

Structure

RHD(F223V,S225F)

Key changes from standard allele

667T>G (F223V)
674C>T (S225F)

ISBT allele designation

RHD*30
RHD*DTO

Nucleotide changes relative to "standard RHD"

c.[667 T>G;674 C>T]

Amino acid changes relative to standard protein

F223V, S225F

Haplotype (typical)

not reported

Allele cluster

weak D type 4 cluster

Descriptions

First full publication: 2005 Denomme GA et. al. Transfusion. 2005 Oct;45(10):1554-60.

ISBT group

partial RHD

Phenotype characterization and grouping

weakened D expression; Partial D

Serology

No data

Observations

Canada (general): Denomme GA et. al. Transfusion. 2005 Oct;45(10):1554-60.

Related Alleles

RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
RHD(M218I, F223V, S225F) [RHD(IVS3-19dup37,609G>A,654G>C,667T>G,674C>T)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]
RHDpsi-OT1 []

Additional comments

No extensive serology, partial D phenotype suggested by type of mutations only

Last update: 2012-03-25 (yyyy-MM-dd)