RHD(1228-2del21)

Structure

RHD(1228-2del21)

Key changes from standard allele

IVS9-2del21

ISBT allele designation

RHD*01N.44

Nucleotide changes relative to "standard RHD"

c.1228-2 del21

Amino acid changes relative to standard protein

not applicable

Haplotype (typical)

not reported

Allele cluster

Eurasian D cluster

Descriptions

First submission to GenBank: 2014 LN680543 (submitted 2014-11-15, released 2014-12-03)

ISBT group

RHD negative

Phenotype characterization and grouping

D negative

Serology

D negative LN680543

Observations

No data

Additional comments

The allele has a deletion of the 22 nt sequence GTTTCCTCATTTGGCTGTTGGA starting at position -2 of IVS 9 and including most of the coding sequence of exon 10

Last update: 2017-06-06 (yyyy-MM-dd)