DFV

Structure

RHD(F223V)

Key changes from standard allele

667T>G (F223V)

ISBT allele designation

RHD*08.01
RHD*DFV

Nucleotide changes relative to "standard RHD"

c.667 T>G

Amino acid changes relative to standard protein

Phe to Val at codon 223

F223V

ISBT group

partial RHD

Phenotype characterization and grouping

Partial D

Haplotype (typical)

multiple

Allele cluster

weak D type 4 cluster

Descriptions

First submission to GenBank: 2002 AF510069 (submitted 2002-05-08, released 2002-11-27)

First full publication: 2002 Noizat-Pirenne F et. al. Blood. 2002 Dec 1;100(12):4223-31. Epub 2002 Aug 1.

Other relevant descriptions:
First use of term DFV Flegel WA et. al. Transfusion. 2008 Jan;48(1):25-33. Epub 2007 Sep 27.
cDE haplotype AM694190 (submitted 2007-04-16, released 2008-03-26)

Serology

Tax MGHM Rh variability in multi-ethnic perspective (thesis): allo-anti-D observed
Same sample as in thesis Grootkerk-Tax MG et. al. Transfusion. 2006 Apr;46(4):606-15.: allo-anti-D observed
No obvious epitope loss Flegel WA et. al. Transfusion. 2008 Jan;48(1):25-33. Epub 2007 Sep 27.: Anti-LW(a)

Observations

French of African ancestry: 1 of 280 D pos donors, in addition 1 alleles in heterozygous state Kappler-Gratias S et. al. Blood Transfus. 2014 Jan;12 Suppl 1:s264-72. doi: 10.2450/2013.0270-12. Epub 2013
India (general): Grootkerk-Tax MG et. al. Transfusion. 2006 Apr;46(4):606-15.
India (general): Fichou Y et. al. Transfusion. 2018 Feb 25. doi: 10.1111/trf.14552.
South-Western Germany: observation in a cDE haplotype population unsure (I have to check) Flegel WA et. al. Transfusion. 2008 Jan;48(1):25-33. Epub 2007 Sep 27.

Related Alleles

Ccdes-1 [RHD(L62F,A137V,N152T)-RHCE(4-7)-RHD(G336C)]
Ccdes-2 [RHD-RHCE(4-7)-RHD(G336C)]
DIIIa-ceS(1-2)-D(3)-ceS(4-7)-D [DIIIa-ceS(1-2)-D(3)-ceS(4-7)-D]
DVI type 2 [RHD-RHCE(4-6)-RHD]
RHD(A137V,N152T)-CE(4-6)-D(7-10) [RHD(A137V,N152T)-CE(4-6)-D(7-10)]
DVI type 1 [RHD-RHcE(4-5)-RHD]
D-SPM [RHD(L62F,A137V,N152T,M170T,F223V)]
DAR1 (weak D type 4.2.0) [RHD(T201R,F223V,I342T)]
DAR(CE2:V50V-S68N) [RHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)]
DAR(T203A) [RHD(T201R,T203A,F223V,I342T)]
DAR-E [RHD(T201R,F223V,E233Q,I342T)[957G>A]]
DAR2.1 [RHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]]
DAU-5 [RHD(F223V,E233Q,T379M)]
DCS-1 [RHD(F223V,A226P)]
DFV.1 [RHD(F223V)]
DIII type 5 [RHD(L62F,A137V,N152T,T201R,F223V)]
DIII type 6 [RHD(A137V,N152T,T201R,F223V,A273A)]
DIII type 7 [RHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)]
DIII type 9 [RHD(L62F,A137V,N152T,F223V)]
DIIIa150C [RHD(150T>C,L62F,A137V,N152T,T201R,F223V,819G>A)]
DIV-DOL [RHD(L62F,A137V,N152T,M170T,F223V)]
DLX [RHD(F223V)-RHCE(5:712-6)-RHD]
DOL-1 [RHD(M170T,F223V)]
DOL-2 [RHD(M170T,F223V,L378V)]
DOL-3 [RHD(A137V,M170T,F223V)]
DOL-4 []
DTO [RHD(F223V,S225F)]
RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
DAU-5.1 [RHD(F223V,E233Q,T379M)[1122C>T]]
RHD(F223V,G278V) [RHD(F223V,G278V)]
RHD(F223V,K267M) [RHD(F223V,K267M)]
RHD(I60L,N152T,T201R,F223V,G263R) [RHD(I60L,N152T,T201R,F223V,G263R)]
weak D type 4.4 [RHD(K198N,T201R,F223V)]
DIVa-like [RHD(L62F,A137V,N152T,F223V,D350H)]
RHD(M218I, F223V, S225F) [RHD(IVS3-19dup37,609G>A,654G>C,667T>G,674C>T)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]
RHD(N152T,T201R,F223V) [RHD(N152T,T201R,F223V)]
RHD(T201R,F223V,G307R) [RHD(T201R,F223V,G307R)]
weak D type 4.5 [RHD(T201R,F223V,G355S)]
RHD(T201R,F223V,K264N,A273A) [RHD(T201R,F223V,K264N,A273A)]
RHD-RHCE(3)--weak D type 4.0 [RHD-RHCE(3)-RHD(T201R,F223V,819G>A)]
RHDpsi-OT1 []
weak D type 29 [RHD(I60L,S68N,K198N,F223V,I342T)]
RHD(I60L,S68N,K198N,F223V,G314V,I342T) [RHD(I60L,S68N,K198N,F223V,G314V,I342T)]
weak D type 4.0 [RHD(T201R,F223V)[819G>A]]
weak D type 4.0.1 [RHD(T201R,F223V)]
weak D type 4.1 [RHD(W16C,T201R,F223V)]
weak D type 4.2.1 (DAR1.1) [RHD(T201R,F223V,,I342T)[957G>A]]
weak D type 4.2.2 (DAR1.2) [RHD(T201R,F223V,I342T)[744C>T,957G>A]]
weak D type 4.2.3 (DAR1.3) [RHD(T201R,F223V,I342T)[744C]]
weak D type 4.3 [RHD(T201R,F223V,P291R)[819G>A]]
DBS-0 [RHD-RHcE(5:667-5:712)-RHD]
DBS-1 [RHD-RHcE(5:667-5:800)-RHD]
DBS-2 [RHD-RHcE(5:667-5:697)-RHD]
DBT-1 [RHD-RHCe(5-7)-RHD]
DBT-2 [RHD-RHCe(5-9)-RHD]
DBU [RHD-cE(5-7;226P)-D]
DVI type 4 [RHD-RHCE(3-5)-RHD]
DV type 1 [RHD-RHCE(5:667-5:697)-RHD]
DV type 2 [RHD-RHCE(5)-RHD]
RHD(T201R)-CE(5)-D(I342T) [RHD(T201R)-CE(5)-D(I342T)]
DV type 6 [RHD-RHCE(5:667-5:712)-RHD]
DV type 8 [RHD-RHCE(5:667-5:744)-RHD]
DV type 7 [RHD-RHCE(5:667-5:787)-RHD]
DVI type 3 [RHD-RHCE(3-6)-RHD]
DVI type 3.2 [RHD-RHCE(3-6)-RHD(A399T)]
DV type 10 [RHD-RHCE(5-6)-RHD]
RHCE(1-9)-RHD [RHCE(1-9)-RHD]
RHD-RHCE(2-10) [RHD-RHCE(2-10)]
RHD-RHCe(2-7)-RHD [RHD-RHCE(3-7)-RHD]
RHD(L110P)-CE(3-9)-D [RHD(L110P)-CE(3-9)-D]
RHD(S68T)-RHCe(3-9)-RHD [RHD(S68T)-RHCE(3-9)-RHD]
RHD-RHCe(2-9)-RHD [RHD-RHCe(2-9)-RHD]
RHD-RHCe(2-9)-RHD1 [RHD-RHCE(3-9)-RHD]
RHD-RHCe(2-9)-RHD2 [RHD-RHCE(3-9)-RHD]
RHD-RHCE(4-7)-RHD [RHD-RHCE(4-7)-RHD]
RHD-RHCE(4-7)-RHD1 [RHD-RHCE(4-7)-RHD]
RHD-RHCE(4-7)-RHD2 [RHD-RHCE(4-7)-RHD]
RHD-RHCE(4-8)-RHD [RHD-RHCE(4-7)-RHD]
RHD-RHCE(4-9)-RHD [RHD-RHCE(4-9)-RHD]
RHD-cE(5-6)-D [RHD-cE(5-6)-D]
RHD-RHCE[245V](5)-RHD [RHD-RHCE[245V](5)-RHD]
RHD-RHCE(2-5)-RHD [RHD-RHCE(2-5)-RHD]

Additional comments

The sequence AF510069 contains an additional 654G>C substitution which is likely a clerical error because it is present in several sequences of different alleles submitted by the same author. too. The term DFV was coined in Flegel et al. 2008

Last update: 2018-05-23 (yyyy-MM-dd)