RHD(Y269X)

Structure

RHD(Y269X)

Key changes from standard allele

807T>G (Y269X)

ISBT allele designation

RHD*01N.18

Nucleotide changes relative to "standard RHD"

c.807 T>G

Amino acid changes relative to standard protein

Tyr to Stop at codon 269

Y269X

Haplotype (typical)

CDe

Allele cluster

Eurasian D cluster

Descriptions

First mention in abstract form: 2004 Flegel WA & et al. Blood (ASH Annual Meeting Abstracts) 2004 104: Abstract 2706

First submission to GenBank: 2008 AM998550 (submitted 2008-05-09, released 2008-08-02)

First full publication: 2009 Flegel WA et. al. Transfusion. 2009 Mar;49(3):465-71. (submitted 2008-05-23)

ISBT group

RHD negative

Phenotype characterization and grouping

D negative

Serology

No data

Observations

No data

Related Alleles

RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]

Additional comments

Last update: 2012-03-25 (yyyy-MM-dd)