RHD psi

Structure

RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)

Key changes from standard allele

609G>A
654G>C (M218I)
667T>G (F223V)
674C>T (S225F)
807T>G (Y269X)
IVS3-19 dupl 37

ISBT allele designation

RHD*08N.01
RHD*Pseudogene

Nucleotide changes relative to "standard RHD"

c.[609 G>A;654 G>C;667 T>G;674 C>T;807 T>G]

Amino acid changes relative to standard protein

, M218I, F223V, S225F, Y269X

ISBT group

RHD negative

Phenotype characterization and grouping

D negative

Haplotype (typical)

cDe

Allele cluster

weak D type 4 cluster

Descriptions

First full publication: 2000 Singleton BK et. al. Blood. 2000 Jan 1;95(1):12-8.

Serology

D negative Wagner FF et. al. BMC Genet. 2001;2:10. Epub 2001 Jul 16.

Observations

Brazaville and Teke groups: Second most frequent allele among D negatives, allele frequency 0.20560 Touinssi M et. al. Transfusion. 2009 Jul;49(7):1353-60.
South Africa (general): Frequency 0.0714 in South African Blacks Singleton BK et. al. Blood. 2000 Jan 1;95(1):12-8.
Canada (general): 4 of about 4000 D negative donors St-Louis R & et al. Vox Sanguinis (2012) 103 (Suppl. 1), 1â??271 Abstract 3C-S8-03
Tunisia (general): Frequency 0.0023 among D negatives Moussa H et. al. Transfus Med. 2012 Mar 16. doi: 10.1111/j.1365-3148.2012.01142.x.
African American: SWiTCH trial Chou ST et. al. Blood Adv. 2017 Aug 3;1(18):1414-1422. doi: 10.1182/bloodadvances.2017007898. Frequency 1:0,019
South-Western Germany: Wagner FF et. al. BMC Genet. 2001;2:10. Epub 2001 Jul 16. Frequency 1:37.431

Related Alleles

RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]

Additional comments

Also allowed ISBT name RHD*& Psi . In older versions of the ISBT nomenclature, numbering was RHD*04N.01

Last update: 2018-02-18 (yyyy-MM-dd)