RHD(609G>A,654G>C,667T>G,674C>T,807T>G)
609G>A
654G>C (M218I)
667T>G (F223V)
674C>T (S225F)
807T>G (Y269X)
No designation assigned
c.[609 G>A;654 G>C;667 T>G;674 C>T;807 T>G]
, M218I, F223V, S225F, Y269X
D negative
not reported
weak D type 4 cluster
First submission to GenBank: 2009 FN555129 (submitted 2009-09-30, released 2009-10-12)
No data
Germany (general): FN555129
RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
This allele was submitted to GenBank as RHD(Y269X). It is similar to RHD psi, but lacks the insertion at the intron 3/ exon 4-boundary.
Last update: 2014-08-03 (yyyy-MM-dd)