RHD: Alleles by proposed non-numerical ISBT name

Note: There are up to two proposed non-numerical ISBT designations per allele, therefore alleles may appear duplicate in this list

ISBT nameDesignationHaplotypePhenotypeClusterStructureFirst mentionDefinitive publication
RHD(S68T)weak D type 74not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
RHD* 01W.141weak D type 141cDePartial D
weakened D expression
weak D type
Eurasian D clusterRHD(F223S)20152016
RHD* DIV.3DIV type 3CDePartial D
D category
Eurasian D clusterRHD-RHCE(6-9)-RHD19991999
RHD* DIVbDIVb type 2CDePartial DEurasian D clusterRHD-RHCE(7:1048-9)-RHD19951995
RHD*01EL.17RHD(Y401X)cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD*01EL.22RHD(IVS2-2delA)not reportedDEL
Partial D
Eurasian D clusterRHD(IVS2-2delA)2013
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
RHD*01EL.46weak D type 94CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD*01N.52RHD(G308X)CDeD negativeEurasian D clusterRHD(G308X)2010
RHD*01N.57RHD(L337R)CDeD negative
Eurasian D clusterRHD(L337R)20142014
RHD*01N.78RHD(660delG)CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*1007ARHD(G336D)not reportedD negativeEurasian D clusterRHD(G336D)2011
RHD*1074-2CRHD(IVS7-2A>C)not reportedEurasian D clusterRHD(IVS7-2A>C)2011
RHD*1179ARHD(W393X)not reportedEurasian D clusterRHD(W393X)20142014
RHD*1228-1ARHD(IVS9-1G>A)CDeEurasian D clusterRHD(IVS9-1G>A)20142014
RHD*16.03DBS-2cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
RHD*424_426delATGRHD(142delM)not reportedD negativeEurasian D clusterRHD(142delM)
RHD*443GRHD(T148R)not reportedD negativeEurasian D clusterRHD(T148R)2012
RHD*581_582insGRHD(581insG)not reportedEurasian D clusterRHD(581insG)
RHD*660delGRHD(660delG)CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*697delGRHD(697delG)not reportedD negativeEurasian D clusterRHD(697delG)
RHD*702delGRHD(702delG)not reportedD negativeEurasian D clusterRHD(702delG)2017
RHD*896CRHD(L299P)not reportedEurasian D clusterRHD(L299P)2011
RHD*D-SPMD-SPMcDePartial DDIVa clusterRHD(L62F,A137V,N152T,M170T,F223V)2012
RHD*DARDAR(T203A)cDePartial Dweak D type 4 clusterRHD(T201R,T203A,F223V,I342T)20122012
RHD*DAR(SE2:v50V-S68N)DAR(CE2:V50V-S68N)cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
RHD*DAR1.00DAR1 (weak D type 4.2.0)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)19981999
RHD*DAR1.01weak D type 4.2.1 (DAR1.1)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
RHD*DAR1.03weak D type 4.2.3 (DAR1.3)cDeweak D type
Partial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C]2008
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[957G>A]20062006
RHD*DAR2.01DAR2.1not reportedPartial Dweak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]
RHD*DAR3weak D type 4.0cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)[819G>A]19991999
RHD*DAR3weak D type 4.0.1cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)
RHD*DAR4weak D type 4.1cDeweak D type
weakened D expression
weak D type 4 clusterRHD(W16C,T201R,F223V)20002000
RHD*DAR6DAR(CE2:V50V-S68N)cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
RHD*DAU0DAU-0cDeD positive (apparently normal)
Partial D
DAU clusterRHD(T379M)20022002
RHD*DAU0.01DAU-0.1cDeDAU clusterRHD(579G>A,1136C>T)20032003
RHD*DAU0.02DAU-0.2not reportedEurasian D clusterRHD(150T>C,1136C>T)
RHD*DAU1DAU-1cDePartial DDAU clusterRHD(S230I,T379M)20022002
RHD*DAU10DAU-10not reportedD positive (no further data)DAU clusterRHD(V247L,T379M)[579G>A]20122012
RHD*DAU11DAU-11cDeweakened D expressionDAU clusterRHD(A85V,V279M,T379M)20122016
RHD*DAU12DAU-12cDeDAU clusterRHD(L181P,T379M)2012
RHD*DAU13DAU-13cDeDAU clusterRHD(W16C,T379M)2013
RHD*DAU14DAU-14cDeD positive (no further data)DAU clusterRHD(S68N,T379M)[201G>A]20142014
RHD*DAU15RHD(M1V,T379M)not reportedDAU clusterRHD(M1V,T379M)2008
RHD*DAU2DAU-2cDePartial D
weakened D expression
DAU clusterRHD(R70Q,S333N,T379M)20022002
RHD*DAU3DAU-3cDePartial DDAU clusterRHD(V279M,T379M)20022002
RHD*DAU4DAU-4cDePartial D
weakened D expression
DAU clusterRHD(E233K,T379M)20022002
RHD*DAU5DAU-5cDePartial DDAU clusterRHD(F223V,E233Q,T379M)20052005
RHD*DAU5.01DAU-5.1cDeweakened D expressionDAU clusterRHD(F223V,E233Q,T379M)[1122C>T]20142016
RHD*DAU6DAU-6cDePartial DDAU clusterRHD(S333N,T379M)20052005
RHD*DAU7DAU-7cDePartial DDAU clusterRHD(V279M,S333N,T379M)20092009
RHD*DAU8DAU-8not reportedD positive (no further data)DAU clusterRHD(R114W,T379M)[579G>A]20122012
RHD*DAU9DAU-9not reportedD positive (no further data)DAU clusterRHD(F179L,T379M)20122012
RHD*DBADBAnot reportedweakened D expressionEurasian D clusterRHD(L227P)20032004
RHD*DBS1DBS-1cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:800)-RHD20012001
RHD*DBS2DBS-2cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
RHD*DBT1DBT-1CDePartial DEurasian D clusterRHD-RHCe(5-7)-RHD19961996
RHD*DBT2DBT-2CDePartial DEurasian D clusterRHD-RHCe(5-9)-RHD19991999
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
RHD*DCCDCCCDePartial DEurasian D clusterRHD(A226D)20072012
RHD*DCS1DCS-1cDEPartial DEurasian D clusterRHD(F223V,A226P)19992008
RHD*DCS2DCS-2cDEPartial DEurasian D clusterRHD(A226P)20082008
RHD*DDEDDEnot reportedPartial DEurasian D clusterRHD(D40E)2007
RHD*DDNDDNnot reportedPartial DEurasian D clusterRHD(D164N)2008
RHD*DEL1RHD(1227G>A)CDeDELEurasian D clusterRHD(1227G>A)20012001
RHD*DEL10RHD(W408R)CDeDELEurasian D clusterRHD(W408R)20052005
RHD*DEL11RHD(X418L)CDeDELEurasian D clusterRHD(X418L)20052005
RHD*DEL12RHD(L153P)cDEDELEurasian D clusterRHD(L153P)20042009
RHD*DEL13RHD(786del A)CDeD negativeEurasian D clusterRHD(785del A)20042009
RHD*DEL14RHD(IVS4+5G>T)CDeweakened D expressionEurasian D clusterRHD(IVS4+5G>T)20102013
RHD*DEL15RHD(G308X)CDeD negativeEurasian D clusterRHD(G308X)2010
RHD*DEL16RHD(G212R)cDeDELEurasian D clusterRHD(G212R)20082009
RHD*DEL17RHD(Y401X)cDED negativeEurasian D clusterRHD(Y401X)20042005
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD*DEL19RHD(IVS4-2A>G)not reportedweakened D expressionEurasian D clusterRHD(IVS4-2A>G)20102011
RHD*DEL2RHD(M1I)not reportedDELEurasian D clusterRHD(M1I)20062006
RHD*DEL20RHD(IVS8-8T>A)not reportedweakened D expressionEurasian D clusterRHD(IVS8-8T>A)20072007
RHD*DEL21RHD(IVS1+5G>C)not reportedDELEurasian D clusterRHD(IVS1+5G>C)2013
RHD*DEL24DEL RHD(A280T)not reportedDELEurasian D clusterRHD(A280T)20142014
RHD*DEL25DEL RHD(X418K)CDeDELEurasian D clusterRHD(X418K)20152015
RHD*DEL26RHD(1248insG)CDeDELEurasian D clusterRHD(1248insG)20142014
RHD*DEL28RHD(993delC)not reportedDELEurasian D clusterRHD(993delC)2014
RHD*DEL29RHD(D404H)cDEDELEurasian D clusterRHD(D404H)2012
RHD*DEL3RHD(L18P)not reportedDELEurasian D clusterRHD(L18P)20062006
RHD*DEL30RHD(del Ex8)not reportedDELEurasian D clusterRHD(del Ex8)20072007
RHD*DEL31RHD(IVS1+1G>T)cDEDELEurasian D clusterRHD(1481G>T)20142014
RHD*DEL32RHD(IVS1-29G>C)CDeDELEurasian D clusterRHD(IVS1-29G>C)2012
RHD*DEL33RHD(IVS2-2A>G)not reportedDELEurasian D clusterRHD(IVS2-2A>G)20112011
RHD*DEL36RHD(IVS7+152C>A,1227G>A)CDeDELEurasian D clusterRHD(IVS7+152C>A,1227G>A)20022002
RHD*DEL37RHD(IVS8-31C>T)not reportedDELEurasian D clusterRHD(IVS8-31C>T)2012
RHD*DEL38RHD(L337R)CDeD negative
Eurasian D clusterRHD(L337R)20142014
RHD*DEL39RHD(L38X)not reportedDELEurasian D clusterRHD(L38X)2010
RHD*DEL4RHD(147del A)CDeDELEurasian D clusterRHD(147del A)20042009
RHD*DEL40RHD(L93R)CDeDELEurasian D clusterRHD(L93R)20142014
RHD*DEL41RHD(P291R)CDeDELEurasian D clusterRHD(P291R)2012
RHD*DEL42RHD(S112T)not reportedDELEurasian D clusterRHD(S112T)2012
RHD*DEL43RHD(W16R)cDEDELEurasian D clusterRHD(W16R)2012
RHD*DEL44RHD-RHCE(4-9)-RHDCDeDELEurasian D clusterRHD-RHCE(4-9)-RHD20092009
RHD*DEL45RHD(T241P)not reportedEurasian D clusterRHD(T241P)
RHD*DEL5RHD(IVS1+1G>A)not reportedDELEurasian D clusterRHD(IVS1+1G>A)2001
RHD*DEL6RHD(L84P)not reportedDELEurasian D clusterRHD(L84P)20062006
RHD*DEL7RHD(A137E)CDeDELEurasian D clusterRHD(A137E)20062009
D negative
Eurasian D clusterRHD(IVS3+1G>A)20012001
RHD*DEL9RHD(IVS3+2T>A)cDED negativeEurasian D clusterRHD(IVS3+2T>A)20082009
RHD*DFLDFLCDePartial DEurasian D clusterRHD(Y165C)20052007
RHD*DFR1DFR-1multiplePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD19951995
RHD*DFR2DFR-2CDePartial DEurasian D clusterRHD-RHCE(4)-RHD19971997
RHD*DFR3DFR-3CDePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD(G180A)20072007
RHD*DFR4DFR-4CDePartial DEurasian D clusterRHD-RHCE(4:505-4:509)-RHD20092012
RHD*DFR5DFR-5not reportedPartial DEurasian D clusterRHD-RHCE(3-4)-RHD2007
RHD*DFVDFVmultiplePartial Dweak D type 4 clusterRHD(F223V)20022002
RHD*DFWDFWCDePartial DEurasian D clusterRHD(H166P)19982009
RHD*DHMiDHMicDEPartial DEurasian D clusterRHD(T283I)1996
weakened D expression
Eurasian D clusterRHD(K235T)20012001
RHD*DHQDHQnot reportedPartial DEurasian D clusterRHD(H171Q)2004
RHD*DHRDHRnot reportedPartial DEurasian D clusterRHD(R229K)19971997
D category
Eurasian D clusterRHD(A354D)19971997
RHD*DII.04.02DIII type 4.2not reportedEurasian D clusterRHD(L62F,S103P,A137V,N152T)
RHD*DIII.07DIII type 7cDePartial D
D category
DIVa clusterRHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)20052006
RHD*DIII.08DIII type 8not reportedPartial D
D category
DIVa clusterRHD(A137V,N152T)2010
RHD*DIII.09DIII type 9not reportedPartial DDIVa clusterRHD(L62F,A137V,N152T,F223V)
RHD*DIII.4DIII type 4CDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T)20002000
RHD*DIII.6DIII type 6cDePartial D
D category
DIVa clusterRHD(A137V,N152T,T201R,F223V,A273A)20052006
RHD*DIIIaDIII type 5cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,T201R,F223V)
D category
Eurasian D clusterRHD-RHCE(3)-RHD19961996
weakened D expression
Eurasian D clusterRHD(C285Y)20002000
RHD*DIV.4DIV type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(7:1048-7:1061)-RHD1998
RHD*DIV.5DIV type 5cDEPartial D
D category
Eurasian D clusterRHD-RHCE(7-9)-RHD20002000
RHD*DIVa.DIV type 1.0cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,D350H)2012
RHD*DKKDKKcDEPartial DEurasian D clusterRHD-RHCE(2-3)-RHD20002001
RHD*DLODLOnot reportedweakened D expression
Partial D
Eurasian D clusterRHD(S284L)20032004
RHD*DLXDLXcDEPartial DEurasian D clusterRHD(F223V)-RHCE(5:712-6)-RHD20122012
RHD*DMADMAcDeEurasian D clusterRHD(L207F)20032003
RHD*DMHDMHcDePartial DEurasian D clusterRHD(L54P)1999
RHD*DMIDMICDePartial DEurasian D clusterRHD(M170I)20082009
RHD*DMI-1.1DMI-1.1CDePartial DEurasian D clusterRHD(M170I)2010
RHD*DNAKDNAKcDEPartial DEurasian D clusterRHD(G357D)2005
RHD*DNBDNBCDePartial DEurasian D clusterRHD(G355S)20022002
RHD*DNSDNSnot reportedPartial DEurasian D clusterRHD(N162S)2006
RHD*DNUDNUcDEPartial DEurasian D clusterRHD(G353R)19971997
RHD*DOL1DOL-1cDePartial Dweak D type 4 clusterRHD(M170T,F223V)19992009
RHD*DOL2DOL-2not reportedPartial Dweak D type 4 clusterRHD(M170T,F223V,L378V)20052009
RHD*DOL3DOL-3not reportedPartial Dweak D type 4 clusterRHD(A137V,M170T,F223V)2005
RHD*DOL4DOL-4not reportedPartial DDIVa cluster
RHD*DTODTOnot reportedweakened D expression
Partial D
weak D type 4 clusterRHD(F223V,S225F)20052005
RHD*DUC2DUC-2not reportedD positive (apparently normal)Eurasian D clusterRHD(V245L)20052005
RHD*DV.1DV type 1CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:697)-RHD19951995
RHD*DV.10DV type 10not reportedPartial DEurasian D clusterRHD-RHCE(5-6)-RHD
RHD*DV.2DV type 2CDePartial D
D category
Eurasian D clusterRHD-RHCE(5)-RHD19951995
RHD*DV.3DBS-0CDePartial DEurasian D clusterRHD-RHcE(5:667-5:712)-RHD19961996
RHD*DV.4DV type 4CDePartial D
D category
Eurasian D clusterRHD(E233Q)19981999
RHD*DV.5DHKCDePartial DEurasian D clusterRHD(E233K)19981999
RHD*DV.6DV type 6CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:712)-RHD19981999
RHD*DV.7DV type 7CDeD category
Partial D
Eurasian D clusterRHD-RHCE(5:667-5:787)-RHD20012001
RHD*DV.8DV type 8CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:744)-RHD19981999
RHD*DV.9DV type 9CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:697-5:712)-RHD19992000
RHD*DVI.03.02DVI type 3.2not reportedPartial DEurasian D clusterRHD-RHCE(3-6)-RHD(A399T)
RHD*DVI.1DVI type 1cDED category
Partial D
Eurasian D clusterRHD-RHcE(4-5)-RHD19971997
RHD*DVI.2DVI type 2CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(4-6)-RHD19941994
RHD*DVI.3DVI type 3CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(3-6)-RHD19981998
RHD*DVI.4DVI type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(3-5)-RHD20002006
D category
Eurasian D clusterRHD(L110P)19951995
RHD*DVII.2DVII type 2CDePartial DEurasian D clusterRHD(S103P,L110P)20012001
RHD*DVL1DVL-1not reportedPartial DEurasian D clusterRHD(229delR)20042006
RHD*DVL2DVL-2not reportedPartial D
weakened D expression
Eurasian D clusterRHD(235delK)20062006
RHD*DWIDWICDePartial DEurasian D clusterRHD(M358T)20042004
RHD*DWNDWNcDePartial DEurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20132013
RHD*DYUDYUcDePartial DEurasian D clusterRHD(R234W)20032005
RHD*PseudogeneRHD psicDeD negativeweak D type 4 clusterRHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)20002000
RHD*weak 4.2weak D type 4.2.1 (DAR1.1)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
RHD*weak 4.3weak D type 4.3cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V,P291R)[819G>A]2004
RHD*weak D type 1weak D type 1CDeweak D type
weakened D expression
Eurasian D clusterRHD(V270G)19991999
RHD*weak D type 1.1weak D type 1.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(L18V,V270G)20042005
RHD*weak D type 1.2weak D type 1.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(V238M,V270G)20142014
RHD*weak D type 10weak D type 10cDEweak D type
weakened D expression
Eurasian D clusterRHD(W393R)19991999
RHD*weak D type 10.1weak D type 10.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P,W393R)2016
RHD*weak D type 10.2weak D type 10.2not reportedweakened D expression
weak D type
Eurasian D clusterRHD(W393R,K400T)20152016
RHD*weak D type 100weak D type 100CDeweak D type
weakened D expression
Eurasian D clusterRHD(G263R)2010
RHD*weak D type 101weak D type 101not reportedweakened D expression
weak D type
Eurasian D clusterRHD(E21A)2015
RHD*weak D type 102weak D type 102multipleweakened D expression
weak D type
Eurasian D clusterRHD(I25F)2016
RHD*weak D type 103weak D type 103not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F31I)2015
RHD*weak D type 104RHD(D53Y)not reportedweakened D expressionEurasian D clusterRHD(D53Y)2015
RHD*weak D type 105weak D type 105not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S67W)20152015
RHD*weak D type 106weak D type 106cDEweak D type
weakened D expression
Eurasian D clusterRHD(W74G)20152015
RHD*weak D type 107weak D type 107not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S75C)2015
RHD*weak D type 108RHD(G96D)not reportedweakened D expressionEurasian D clusterRHD(G96D)20152015
RHD*weak D type 109weak D type 109not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S126P)2015
RHD*weak D type 110weak D type 110not reportedweakened D expression
weak D type
Eurasian D clusterRHD(Q138R)20152015
RHD*weak D type 111weak D type 111not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212S)2015
RHD*weak D type 112weak D type 112not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212D)20152015
RHD*weak D type 113weak D type 113not reportedweak D type
weakened D expression
Eurasian D clusterRHD(W292R)2015
RHD*weak D type 114weak D type 114not reportedweakened D expression
weak D type
Eurasian D clusterRHD(P323L)20152015
RHD*weak D type 115weak D type 115CDeweakened D expression
weak D type
Eurasian D clusterRHD(M328K)20152015
RHD*weak D type 116weak D type 116not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116P)20152015
RHD*weak D type 117weak D type 117not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116T)2015
RHD*weak D type 118weak D type 118not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116V)2010
RHD*weak D type 119weak D type 119CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273V)2010
RHD*weak D type 12weak D type 12CDeweak D type
weakened D expression
Eurasian D clusterRHD(G277E)19991999
RHD*weak D type 120weak D type 120CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273E)2010
RHD*weak D type 121weak D type 121not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A59D)2015
RHD*weak D type 122weak D type 122not reportedweakened D expression
weak D type
Eurasian D clusterRHD(R70W)2011
RHD*weak D type 123weak D type 123not reportedweakened D expression
weakened D expression
Eurasian D clusterRHD(V127L)2015
RHD*weak D type 124weak D type 124not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K198N)2015
RHD*weak D type 125weak D type 125not reportedweakened D expression
weak D type
Eurasian D clusterRHD(N224S)2015
RHD*weak D type 126weak D type 126not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K400I)2015
RHD*weak D type 127weak D type 127not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K400N)2012
RHD*weak D type 128weak D type 128not reportedweakened D expression
weak D type
Eurasian D clusterRHD(D403Y)2015
RHD*weak D type 129weak D type 129CDeweakened D expression
weak D type
Eurasian D clusterRHD(D403V)20122012
RHD*weak D type 13weak D type 13CDeweak D type
weakened D expression
Eurasian D clusterRHD(A276P)19991999
RHD*weak D type 130weak D type 130CDeweakened D expression
weak D type
Eurasian D clusterRHD(T55P)20112012
RHD*weak D type 131weak D type 131CDeweakened D expression
weak D type
Eurasian D clusterRHD(A85G)20122012
RHD*weak D type 132weak D type 132CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132R)20102012
RHD*weak D type 133weak D type 133CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132E)20122012
RHD*weak D type 134weak D type 134not reportedweak D typeEurasian D clusterRHD(L390V)2012
RHD*weak D type 135weak D type 135not reportedweak D type
weakened D expression
Eurasian D clusterRHD(M295K)2016
RHD*weak D type 136weak D type 136not reportedweak D typeEurasian D clusterRHD(P14L)2016
RHD*weak D type 137weak D type 137not reported
weak D type
Eurasian D clusterRHD(H260Q)2016
RHD*weak D type 138weak D type 138not reportedweak D typeEurasian D clusterRHD(P291S)2016
RHD*weak D type 139weak D type 139not reported
weak D type
Eurasian D clusterRHD(L390P)2016
RHD*weak D type 14weak D type 14cDEweak D type
weakened D expression
Eurasian D clusterRHD(S182T,K198N,T201R)19991999
RHD*weak D type 140weak D type 140not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F410S)20162016
RHD*weak D type 142weak D type 142CDeweakened D expression
weak D type
Eurasian D clusterRHD(A23S)2016
RHD*weak D type 143weak D type 143CDeweakened D expression
weak D type
Eurasian D clusterRHD(A58V)2015
RHD*weak D type 144weak D type 144CDeweakened D expression
weak D type
Eurasian D clusterRHD(E193D)2016
RHD*weak D type 145weak D type 145not reportedEurasian D clusterRHD(P14R)
RHD*weak D type 16weak D type 16cDEweak D type
weakened D expression
Eurasian D clusterRHD(W220R)19991999
RHD*weak D type 17weak D type 17CDEweak D type
weakened D expression
Eurasian D clusterRHD(R114W)20002000
RHD*weak D type 18weak D type 18not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R7W)2000
RHD*weak D type 19weak D type 19cDeweak D type
weakened D expression
Eurasian D clusterRHD(I204T)20062006
RHD*weak D type 2weak D type 2cDEweak D type
weakened D expression
Eurasian D clusterRHD(G385A)19991999
RHD*weak D type 2.1weak D type 2.1cDEweak D type
weakened D expression
Eurasian D clusterRHD(F101I,G385A)2009
RHD*weak D type 2.2weak D type 2.2cDEweak D type
weakened D expression
Eurasian D clusterRHD(V306I,Y311C,G385A)20142014
RHD*weak D type 20weak D type 20cDEweak D typeEurasian D clusterRHD(F417S)20002006
RHD*weak D type 22weak D type 22CDeweak D type
weakened D expression
Eurasian D clusterRHD(W408C)2000
RHD*weak D type 23weak D type 23not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G212C)20012001
RHD*weak D type 24weak D type 24not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L338P)20032003
RHD*weak D type 25weak D type 25not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114Q)2005
RHD*weak D type 26weak D type 26CDeweak D type
weakened D expression
Eurasian D clusterRHD(V9D)20042005
RHD*weak D type 27weak D type 27not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221S)2002
RHD*weak D type 28weak D type 28not reportedweak D type
weakened D expression
Eurasian D clusterRHD(1152A>C)2002
RHD*weak D type 29weak D type 29cDeweak D type
weakened D expression
weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,I342T)20032003
RHD*weak D type 3weak D type 3CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C)19991999
RHD*weak D type 3.1weak D type 3.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C,I60L)20142014
RHD*weak D type 30weak D type 30not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E340M)2003
RHD*weak D type 31weak D type 31CDeweak D type
weakened D expression
Eurasian D clusterRHD(P6L)20042005
RHD*weak D type 32weak D type 32CDeweak D type
weakened D expression
Eurasian D clusterRHD(I374N)20052005
RHD*weak D type 33weak D type 33CDeweak D type
weakened D expression
Eurasian D clusterRHD(V174M)20032003
RHD*weak D type 34weak D type 34not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V270E)20032003
RHD*weak D type 35weak D type 35not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G87D)2003
RHD*weak D type 36weak D type 36not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V281G)2004
RHD*weak D type 37weak D type 37not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K133N)20032004
RHD*weak D type 38weak D type 38CDeweak D type
weakened D expression
Eurasian D clusterRHD(G278D)20032004
RHD*weak D type 39weak D type 39CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339R)2003
RHD*weak D type 40weak D type 40not reportedweak D type
weakened D expression
Eurasian D clusterRHD(T201R)2003
RHD*weak D type 41weak D type 41not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398V)2004
RHD*weak D type 41.01.weak D type 41.0.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L390L,E398V)2016
RHD*weak D type 42weak D type 42not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(K409M)20052005
RHD*weak D type 43weak D type 43CDeweak D type
weakened D expression
Eurasian D clusterRHD(A202V)20062006
RHD*weak D type 44weak D type 44not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243C)2004
RHD*weak D type 45weak D type 45not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(A399T)2004
RHD*weak D type 46weak D type 46not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F407L)2004
RHD*weak D type 47weak D type 47not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114G)2005
RHD*weak D type 48weak D type 48cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61V)2005
RHD*weak D type 49weak D type 49CDeweak D type
weakened D expression
Eurasian D clusterRHD(S257F)20062007
RHD*weak D type 5weak D type 5cDEweak D type
weakened D expression
Eurasian D clusterRHD(A149D)19991999
RHD*weak D type 50weak D type 50not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243N)2006
RHD*weak D type 51weak D type 51not reportedweak D type
weakened D expression
Eurasian D clusterRHD-RHCE(4:594-4:602)-RHD2005
RHD*weak D type 52weak D type 52not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F31S)2005
RHD*weak D type 53weak D type 53CDeweak D type
weakened D expression
Eurasian D clusterRHD(V247G)2005
RHD*weak D type 54weak D type 54cDEweak D type
weakened D expression
Eurasian D clusterRHD(S122L)
RHD*weak D type 55weak D type 55cDEweak D type
weakened D expression
Eurasian D clusterRHD(L299V)2007
RHD*weak D type 56weak D type 56not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A22E)20072007
RHD*weak D type 58weak D type 58CDeweak D type
weakened D expression
Eurasian D clusterRHD(G336R)20072007
RHD*weak D type 59weak D type 59not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L383P)20072007
RHD*weak D type 6weak D type 6CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10Q)19991999
RHD*weak D type 60weak D type 60not reportedweak D type
weakened D expression
Eurasian D clusterRHD(407delFW)20072007
RHD*weak D type 61weak D type 61CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10W)20062006
RHD*weak D type 62weak D type 62not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221T)2006
RHD*weak D type 63weak D type 63not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I253N)2007
RHD*weak D type 64weak D type 64not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A294V)2007
RHD*weak D type 65weak D type 65cDeweak D type
weakened D expression
Eurasian D clusterRHD(A23D)2008
RHD*weak D type 66weak D type 66CDeweak D type
weakened D expression
Eurasian D clusterRHD(V306I)2007
RHD*weak D type 67weak D type 67cDEweak D type
weakened D expression
Eurasian D clusterRHD(T241I)2008
RHD*weak D type 68weak D type 68not reportedweak D type
weakened D expression
Eurasian D clusterRHD(165C>T,1213C>G)2006
RHD*weak D type 69weak D type 69not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R318Q)2008
RHD*weak D type 7weak D type 7CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339E)19991999
RHD*weak D type 70weak D type 70CDeweak D type
weakened D expression
Eurasian D clusterRHD(L338V)2008
RHD*weak D type 71weak D type 71not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R10P)2009
RHD*weak D type 72weak D type 72not reportedweak D type
weakened D expression
Eurasian D clusterRHD(D404E)2007
RHD*weak D type 73weak D type 73not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A414V)2009
RHD*weak D type 74weak D type 74not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
RHD*weak D type 75weak D type 75not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398D)2010
RHD*weak D type 76weak D type 76not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Q405H)2010
RHD*weak D type 77weak D type 77not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S256P)20102011
RHD*weak D type 78weak D type 78CDeweakened D expression
weak D type
Eurasian D clusterRHD(F410V)20092011
RHD*weak D type 79weak D type 79not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L187P)2012
RHD*weak D type 8weak D type 8CDeweak D type
weakened D expression
Eurasian D clusterRHD(G307R)19991999
RHD*weak D type 80weak D type 80not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G180E)2012
RHD*weak D type 81weak D type 81CDeweak D type
weakened D expression
Eurasian D clusterRHD(K400T)2012
RHD*weak D type 82weak D type 82CDeweak D type
weakened D expression
Eurasian D clusterRHD(A395V)2012
RHD*weak D type 83weak D type 83cDEweakened D expressionEurasian D clusterRHD(L413W)2012
RHD*weak D type 84weak D type 84CDeweak D type
weakened D expression
Eurasian D clusterRHD(S76N)2013
RHD*weak D type 85weak D type 85CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70Q)2010
RHD*weak D type 86weak D type 86not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V345E)2014
RHD*weak D type 87weak D type 87not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I125N)20142015
RHD*weak D type 88weak D type 88cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61A)2014
RHD*weak D type 89weak D type 89CDeweak D type
weakened D expression
Eurasian D clusterRHD(A23P)20142014
RHD*weak D type 9weak D type 9cDEweak D type
weakened D expression
Eurasian D clusterRHD(A294P)19991999
RHD*weak D type 90weak D type 90CDeweak D type
weakened D expression
Eurasian D clusterRHD(N331K)20142014
RHD*weak D type 91weak D type 91CDeweak D type
weakened D expression
Eurasian D clusterRHD(P396R)20142014
RHD*weak D type 92weak D type 92not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P)20142014
RHD*weak D type 93weak D type 93cDEweak D type
weakened D expression
Eurasian D clusterRHD(A120D)2016
RHD*weak D type 94weak D type 94CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
RHD*weak D type 95weak D type 95cDEweak D type
weakened D expression
Eurasian D clusterRHD(A244P)20132013
RHD*weak D type 96weak D type 96cDeweak D type
weakened D expression
Eurasian D clusterRHD(A244V)20132013
RHD*weak D type 97weak D type 97CDeweak D type
weakened D expression
Eurasian D clusterRHD(L181P)20132013
RHD*weak D type 98weak D type 98cDEweak D type
weakened D expression
Eurasian D clusterRHD(T251P)20132013
RHD*weak D type 99weak D type 99CDeweak D type
weakened D expression
Eurasian D clusterRHD(E369D)20132013
RHD*weak partial 11RHD(M295I)CDeDEL
Partial D
Eurasian D clusterRHD(M295I)20012001
RHD*weak partial 11weak D type 11cDeweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(M295I)19991999
RHD*weak partial 15weak D type 15cDEweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(G282D)19991999
RHD*weak partial 57weak D type 57not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(L214F)20072007
RHD*weak partial D 21weak D type 21CDeweak D type
Partial D
weakened D expression
Eurasian D clusterRHD(P313L)20012001
RHDÜweak D type 45.1weak D type 45.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A273V,A399T)2010
RHDÜweak D type 45.2weak D type 45.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70W,A273V,A399T)20132013