RHD(IVS3-19dup37,609G>A,654G>C,667T>G,674C>T)
Caution: This structure most likely does not exist
609G>A
654G>C (M218I)
667T>G (F223V)
674C>T (S225F)
IVS3-19 dupl 37
No designation assigned
c.[609 G>A;654 G>C;667 T>G;674 C>T]
, M218I, F223V, S225F
weakened D expression
CDe
weak D type 4 cluster
First submission to GenBank: 2013 HF674883 (submitted 2013-01-29, released 2013-02-04)
No data
RHD psi [RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)]
RHD(M218I, F223V, S225F,Y269X) [RHD(609G>A,654G>C,667T>G,674C>T,807T>G)]
RHDpsi-OT1 []
This allele in unlikely to exist. Samples assigned to this allele most likely represented The observation of this allele expressing 8884 antigens per cell suggests that the D negative phenotype of