RHD: Alleles sorted by ISBT group and proposed numerical ISBT name

DesignationISBT nameHaplotypePhenotypeClusterStructureFirst mentionDefinitive publication
weak D type 142RHD* 01W.142
RHD*weak D type 142		CDeweakened D expression
weak D type		Eurasian D clusterRHD(A23S)2016
DIII type 9RHD*03.09
RHD*DIII.09		not reportedPartial DDIVa clusterRHD(L62F,A137V,N152T,F223V)
RHD(1227G>A)RHD*01EL.01
RHD*DEL1		CDeDELEurasian D clusterRHD(1227G>A)20012001
RHD(M1I)RHD*01EL.02
RHD*DEL2		not reportedDELEurasian D clusterRHD(M1I)20062006
RHD(L18P)RHD*01EL.03
RHD*DEL3		not reportedDELEurasian D clusterRHD(L18P)20062006
RHD(147del A)RHD*01EL.04
RHD*DEL4		CDeDELEurasian D clusterRHD(147del A)20042009
RHD(IVS1+1G>A)RHD*01EL.05
RHD*DEL5		not reportedDELEurasian D clusterRHD(IVS1+1G>A)2001
RHD(L84P)RHD*01EL.06
RHD*DEL6		not reportedDELEurasian D clusterRHD(L84P)20062006
RHD(A137E)RHD*01EL.07
RHD*DEL7		CDeDELEurasian D clusterRHD(A137E)20062009
RHD(IVS3+1G>A)RHD*01EL.08
RHD*DEL8		CDeDEL
D negative		Eurasian D clusterRHD(IVS3+1G>A)20012001
RHD(IVS3+2T>A)RHD*01EL.09
RHD*DEL9		cDED negativeEurasian D clusterRHD(IVS3+2T>A)20082009
RHD(W408R)RHD*01EL.10
RHD*DEL10		CDeDELEurasian D clusterRHD(W408R)20052005
RHD(X418L)RHD*01EL.11
RHD*DEL11		CDeDELEurasian D clusterRHD(X418L)20052005
RHD(L153P)RHD*01EL.12
RHD*DEL12		cDEDELEurasian D clusterRHD(L153P)20042009
RHD(786del A)RHD*01EL.13
RHD*DEL13		CDeD negativeEurasian D clusterRHD(785del A)20042009
RHD(IVS4+5G>T)RHD*01EL.14
RHD*DEL14		CDeweakened D expressionEurasian D clusterRHD(IVS4+5G>T)20102013
RHD(G308X)RHD*01EL.15
RHD*DEL15
RHD*01N.52		CDeD negativeEurasian D clusterRHD(G308X)2010
RHD(G212R)RHD*01EL.16
RHD*DEL16		cDeDELEurasian D clusterRHD(G212R)20082009
RHD(93insT)RHD*01EL.18
RHD*DEL18
RHD*01N.50		CDeDEL
D negative		Eurasian D clusterRHD(93dupT)20082008
RHD(IVS4-2A>G)RHD*01EL.19
RHD*DEL19		not reportedweakened D expressionEurasian D clusterRHD(IVS4-2A>G)20102011
RHD(IVS8-8T>A)RHD*01EL.20
RHD*DEL20		not reportedweakened D expressionEurasian D clusterRHD(IVS8-8T>A)20072007
RHD(IVS1+5G>C)RHD*01EL.21
RHD*DEL21		not reportedDELEurasian D clusterRHD(IVS1+5G>C)2013
DEL RHD(A280T)RHD*01EL.24
RHD*DEL24		not reportedDELEurasian D clusterRHD(A280T)20142014
DEL RHD(X418K)RHD*01EL.25
RHD*DEL25		CDeDELEurasian D clusterRHD(X418K)20152015
RHD(1248insG)RHD*01EL.26
RHD*DEL26		CDeDELEurasian D clusterRHD(1248insG)20142014
RHD(993delC)RHD*01EL.28
RHD*DEL28		not reportedEurasian D clusterRHD(993delC)2014
RHD(D404H)RHD*01EL.29
RHD*DEL29		cDEDELEurasian D clusterRHD(D404H)2012
RHD(del Ex8)RHD*01EL.30
RHD*DEL30		not reportedDELEurasian D clusterRHD(del Ex8)20072007
RHD(IVS1+1G>T)RHD*01EL.31
RHD*DEL31		cDEDELEurasian D clusterRHD(1481G>T)20142014
RHD(IVS1-29G>C)RHD*01EL.32
RHD*DEL32		CDeDELEurasian D clusterRHD(IVS1-29G>C)2012
RHD(IVS2-2A>G)RHD*01EL.33
RHD*DEL33		not reportedDELEurasian D clusterRHD(IVS2-2A>G)20112011
RHD(IVS7+152C>A,1227G>A)RHD*01EL.36
RHD*DEL36		CDeDELEurasian D clusterRHD(IVS7+152C>A,1227G>A)20022002
RHD(IVS8-31C>T)RHD*01EL.37
RHD*DEL37		not reportedDELEurasian D clusterRHD(IVS8-31C>T)2012
RHD(L337R)RHD*01EL.38
RHD*DEL38
RHD*01N.57		CDeD negative
DEL		Eurasian D clusterRHD(L337R)20142014
RHD(L38X)RHD*01EL.39
RHD*DEL39		not reportedDELEurasian D clusterRHD(L38X)2010
RHD(L93R)RHD*01EL.40
RHD*DEL40		CDeDELEurasian D clusterRHD(L93R)20142014
RHD(P291R)RHD*01EL.41
RHD*DEL41		CDeDELEurasian D clusterRHD(P291R)2012
RHD(S112T)RHD*01EL.42
RHD*DEL42		not reportedDELEurasian D clusterRHD(S112T)2012
RHD(W16R)RHD*01EL.43
RHD*DEL43		cDEDELEurasian D clusterRHD(W16R)2012
RHD-RHCE(4-9)-RHDRHD*01EL.44
RHD*DEL44		CDeDELEurasian D clusterRHD-RHCE(4-9)-RHD20092009
RHD(T241P)RHD*01EL.45
RHD*DEL45		not reportedEurasian D clusterRHD(T241P)
weak D type 57RHD*57
RHD*weak partial 57		not reportedweak D type
weakened D expression
Partial D		Eurasian D clusterRHD(L214F)20072007
DIIRHD*02
RHD*DII		CDePartial D
D category		Eurasian D clusterRHD(A354D)19971997
DIII type 5RHD*03.01
RHD*DIIIa
cDePartial D
D category		DIVa clusterRHD(L62F,A137V,N152T,T201R,F223V)
DIIIcRHD*03.03
RHD*DIIIc		CDePartial D
D category		Eurasian D clusterRHD-RHCE(3)-RHD19961996
DIII type 4RHD*03.04
RHD*DIII.4		CDePartial D
D category		DIVa clusterRHD(L62F,A137V,N152T)20002000
DIII type 4.2RHD*03.04.02
RHD*DII.04.02		not reportedEurasian D clusterRHD(L62F,S103P,A137V,N152T)
DIII type 6RHD*03.06
RHD*DIII.6		cDePartial D
D category		DIVa clusterRHD(A137V,N152T,T201R,F223V,A273A)20052006
DIII type 7RHD*03.07
RHD*DIII.07		cDePartial D
D category		DIVa clusterRHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)20052006
DIII type 8RHD*03.08
RHD*DIII.08		not reportedPartial D
D category		DIVa clusterRHD(A137V,N152T)2010
DIV type 1.0RHD*04.01
RHD*DIVa.		cDePartial D
D category		DIVa clusterRHD(L62F,A137V,N152T,D350H)2012
DIVa-likeRHD*04.01.02not reportedEurasian D clusterRHD(L62F,A137V,N152T,F223V,D350H)
DIV type 3RHD*04.03
RHD* DIV.3		CDePartial D
D category		Eurasian D clusterRHD-RHCE(6-9)-RHD19991999
DIV type 4RHD*04.04
RHD*DIV.4		CDePartial D
D category		Eurasian D clusterRHD-RHCE(7:1048-7:1061)-RHD1998
DIV type 5RHD*04.05
RHD*DIV.5		cDEPartial D
D category		Eurasian D clusterRHD-RHCE(7-9)-RHD20002000
DIVb type 2RHD*04.06
RHD* DIVb		CDePartial DEurasian D clusterRHD-RHCE(7:1048-9)-RHD19951995
DV type 1RHD*05.01
RHD*DV.1		CDePartial D
D category		Eurasian D clusterRHD-RHCE(5:667-5:697)-RHD19951995
DV type 2RHD*05.02
RHD*DV.2		CDePartial D
D category		Eurasian D clusterRHD-RHCE(5)-RHD19951995
DBS-0RHD*05.03
RHD*DV.3		CDePartial DEurasian D clusterRHD-RHcE(5:667-5:712)-RHD19961996
DV type 4RHD*05.04
RHD*DV.4		CDePartial D
D category		Eurasian D clusterRHD(E233Q)19981999
DHKRHD*05.05
RHD*DV.5		CDePartial DEurasian D clusterRHD(E233K)19981999
DV type 6RHD*05.06
RHD*DV.6		CDePartial D
D category		Eurasian D clusterRHD-RHCE(5:667-5:712)-RHD19981999
DV type 7RHD*05.07
RHD*DV.7		CDeD category
Partial D		Eurasian D clusterRHD-RHCE(5:667-5:787)-RHD20012001
DV type 8RHD*05.08
RHD*DV.8		CDePartial D
D category		Eurasian D clusterRHD-RHCE(5:667-5:744)-RHD19981999
DV type 9RHD*05.09
RHD*DV.9		CDePartial D
D category		Eurasian D clusterRHD-RHCE(5:697-5:712)-RHD19992000
DV type 10RHD*05.10
RHD*DV.10		not reportedPartial DEurasian D clusterRHD-RHCE(5-6)-RHD
DVI type 1RHD*06.01
RHD*DVI.1
cDED category
Partial D		Eurasian D clusterRHD-RHcE(4-5)-RHD19971997
DVI type 2RHD*06.02
RHD*DVI.2
CDePartial D
D category
BARC positive		Eurasian D clusterRHD-RHCE(4-6)-RHD19941994
DVI type 3RHD*06.03
RHD*DVI.3		CDePartial D
D category
BARC positive		Eurasian D clusterRHD-RHCE(3-6)-RHD19981998
DVI type 3.2RHD*06.03.02
RHD*DVI.03.02		not reportedPartial DEurasian D clusterRHD-RHCE(3-6)-RHD(A399T)
DVI type 4RHD*06.04
RHD*DVI.4		CDePartial D
D category		Eurasian D clusterRHD-RHCE(3-5)-RHD20002006
DVIIRHD*07.01
RHD*DVII.1		CDePartial D
D category		Eurasian D clusterRHD(L110P)19951995
DVII type 2RHD*07.02
RHD*DVII.2		CDePartial DEurasian D clusterRHD(S103P,L110P)20012001
DFVRHD*08.01
RHD*DFV		multiplePartial Dweak D type 4 clusterRHD(F223V)20022002
DAR(T203A)RHD*09.01
RHD*DAR		cDePartial Dweak D type 4 clusterRHD(T201R,T203A,F223V,I342T)20122012
DAR1 (weak D type 4.2.0)RHD*09.01.00
RHD*DAR1.00
cDePartial D
weak D type
weakened D expression		weak D type 4 clusterRHD(T201R,F223V,I342T)19981999
weak D type 4.2.1 (DAR1.1)RHD*09.01.01
RHD*DAR1.01
RHD*weak 4.2		cDePartial D
weak D type
weakened D expression		weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
weak D type 4.2.2 (DAR1.2)RHD*09.01.02
cDePartial D
weak D type
weakened D expression		weak D type 4 clusterRHD(T201R,F223V,I342T)[744C>T,957G>A]20002000
weak D type 4.2.3 (DAR1.3)RHD*09.01.03
RHD*DAR1.03
cDeweak D type
Partial D
weakened D expression		weak D type 4 clusterRHD(T201R,F223V,I342T)[744C]2008
DAR-ERHD*09.02
RHD*DAR2		cDePartial D
weakened D expression		weak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[957G>A]20062006
DAR2.1RHD*09.02.01
RHD*DAR2.01		not reportedPartial Dweak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]
weak D type 4.0RHD*09.03.01
RHD*DAR3		cDeweak D type
weakened D expression
Partial D		weak D type 4 clusterRHD(T201R,F223V)[819G>A]19991999
weak D type 4.1RHD*09.04
RHD*DAR4		cDeweak D type
weakened D expression		weak D type 4 clusterRHD(W16C,T201R,F223V)20002000
weak D type 4.3RHD*09. 05
RHD*weak 4.3		cDeweak D type
DEL
weakened D expression
Partial D		weak D type 4 clusterRHD(T201R,F223V,P291R)[819G>A]2004
DAR(CE2:V50V-S68N)RHD*09.06
RHD*DAR6
RHD*DAR(SE2:v50V-S68N)		cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
DAU-0RHD*10.00
RHD*DAU0		cDeD positive (apparently normal)
Partial D		DAU clusterRHD(T379M)20022002
DAU-0.2RHD*10.00.02
RHD*DAU0.02		not reportedEurasian D clusterRHD(150T>C,1136C>T)
DAU-1RHD*10.01
RHD*DAU1		cDePartial DDAU clusterRHD(S230I,T379M)20022002
DAU-2RHD*10.02
RHD*DAU2		cDePartial D
weakened D expression		DAU clusterRHD(R70Q,S333N,T379M)20022002
DAU-3RHD*10.03
RHD*DAU3		cDePartial DDAU clusterRHD(V279M,T379M)20022002
DAU-4RHD*10.04
RHD*DAU4		cDePartial D
weakened D expression		DAU clusterRHD(E233K,T379M)20022002
DAU-5RHD*10.05
RHD*DAU5		cDePartial DDAU clusterRHD(F223V,E233Q,T379M)20052005
DAU-5.1RHD*10.05.01
RHD*DAU5.01		cDeweakened D expressionDAU clusterRHD(F223V,E233Q,T379M)[1122C>T]20142016
DAU-6RHD*10.06
RHD*DAU6		cDePartial DDAU clusterRHD(S333N,T379M)20052005
DAU-7RHD*10.07
RHD*DAU7		cDePartial DDAU clusterRHD(V279M,S333N,T379M)20092009
DAU-8RHD*10.08
RHD*DAU8		not reportedD positive (no further data)DAU clusterRHD(R114W,T379M)[579G>A]20122012
DAU-9RHD*10.09
RHD*DAU9		not reportedD positive (no further data)DAU clusterRHD(F179L,T379M)20122012
DAU-10RHD*10.10
RHD*DAU10		not reportedD positive (no further data)DAU clusterRHD(V247L,T379M)[579G>A]20122012
DAU-11RHD*10.11
RHD*DAU11		cDeweakened D expressionDAU clusterRHD(A85V,V279M,T379M)20122016
DAU-12RHD*10.12
RHD*DAU12		cDeDAU clusterRHD(L181P,T379M)2012
DAU-13RHD*10.13
RHD*DAU13		cDeDAU clusterRHD(W16C,T379M)2013
DAU-14RHD*10.14
RHD*DAU14		cDeD positive (no further data)DAU clusterRHD(S68N,T379M)[201G>A]20142014
RHD(M1V,T379M)RHD*10.15
RHD*DAU15		not reportedDAU clusterRHD(M1V,T379M)2008
RHD(M295I)RHD*11
RHD*weak partial 11		CDeDEL
Partial D		Eurasian D clusterRHD(M295I)20012001
weak D type 11RHD*11
RHD*weak partial 11		cDeweak D type
weakened D expression
Partial D		Eurasian D clusterRHD(M295I)19991999
DOL-1RHD*12.01
RHD*DOL1		cDePartial Dweak D type 4 clusterRHD(M170T,F223V)19992009
DOL-2RHD*12.02
RHD*DOL2		not reportedPartial Dweak D type 4 clusterRHD(M170T,F223V,L378V)20052009
DOL-3RHD*12.03
RHD*DOL3		not reportedPartial Dweak D type 4 clusterRHD(A137V,M170T,F223V)2005
DOL-4RHD*12.04
RHD*DOL4		not reportedPartial DDIVa cluster
DBS-1RHD*13.01
RHD*DBS1		cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:800)-RHD20012001
DBS-2RHD*13.02
RHD*DBS2
RHD*16.03		cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
DBT-1RHD*14.01
RHD*DBT1		CDePartial DEurasian D clusterRHD-RHCe(5-7)-RHD19961996
DBT-2RHD*14.02
RHD*DBT2		CDePartial DEurasian D clusterRHD-RHCe(5-9)-RHD19991999
weak D type 15RHD*15
RHD*weak partial 15		cDEweak D type
weakened D expression
Partial D		Eurasian D clusterRHD(G282D)19991999
DCS-1RHD*16.01
RHD*DCS1		cDEPartial DEurasian D clusterRHD(F223V,A226P)19992008
DCS-2RHD*16.02
RHD*DCS2
cDEPartial DEurasian D clusterRHD(A226P)20082008
DFR-1RHD*17.01
RHD*DFR1		multiplePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD19951995
DFR-2RHD*17.02
RHD*DFR2		CDePartial DEurasian D clusterRHD-RHCE(4)-RHD19971997
DFR-3RHD*17.03
RHD*DFR3		CDePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD(G180A)20072007
DFR-4RHD*17.04
RHD*DFR4		CDePartial DEurasian D clusterRHD-RHCE(4:505-4:509)-RHD20092012
DFR-5RHD*17.05
RHD*DFR5		not reportedPartial DEurasian D clusterRHD-RHCE(3-4)-RHD2007
DFWRHD*18
RHD*DFW		CDePartial DEurasian D clusterRHD(H166P)19982009
DHMiRHD*19
RHD*DHMi		cDEPartial DEurasian D clusterRHD(T283I)1996
DHORHD*20
RHD*DHO		CDePartial D
weakened D expression		Eurasian D clusterRHD(K235T)20012001
weak D type 21RHD*21
RHD*weak partial D 21		CDeweak D type
Partial D
weakened D expression		Eurasian D clusterRHD(P313L)20012001
DHRRHD*22
RHD*DHR		not reportedPartial DEurasian D clusterRHD(R229K)19971997
DMHRHD*23
RHD*DMH		cDePartial DEurasian D clusterRHD(L54P)1999
DNAKRHD*24
RHD*DNAK		cDEPartial DEurasian D clusterRHD(G357D)2005
DNBRHD*25
RHD*DNB		CDePartial DEurasian D clusterRHD(G355S)20022002
DNURHD*26
RHD*DNU		cDEPartial DEurasian D clusterRHD(G353R)19971997
DDERHD*27
RHD*DDE		not reportedPartial DEurasian D clusterRHD(D40E)2007
DFLRHD*28
RHD*DFL		CDePartial DEurasian D clusterRHD(Y165C)20052007
DYURHD*29
RHD*DYU		cDePartial DEurasian D clusterRHD(R234W)20032005
DTORHD*30
RHD*DTO		not reportedweakened D expression
Partial D		weak D type 4 clusterRHD(F223V,S225F)20052005
DVL-1RHD*31
RHD*DVL1		not reportedPartial DEurasian D clusterRHD(229delR)20042006
DVL-2RHD*32
RHD*DVL2		not reportedPartial D
weakened D expression		Eurasian D clusterRHD(235delK)20062006
DWIRHD*33
RHD*DWI		CDePartial DEurasian D clusterRHD(M358T)20042004
DIMRHD*34
RHD*DIM		cDEPartial D
weakened D expression		Eurasian D clusterRHD(C285Y)20002000
DMARHD*35
RHD*DMA		cDeEurasian D clusterRHD(L207F)20032003
DLORHD*36
RHD*DLO		not reportedweakened D expression
Partial D		Eurasian D clusterRHD(S284L)20032004
DUC-2RHD*37
RHD*DUC2		not reportedD positive (apparently normal)Eurasian D clusterRHD(V245L)20052005
RHD(S103P)RHD*39cDEPartial DEurasian D clusterRHD(S103P)19961996
D-SPMRHD*40
RHD*D-SPM		cDePartial DDIVa clusterRHD(L62F,A137V,N152T,M170T,F223V)2012
DBURHD*41
RHD*DBU
RHD*01EL.23		cDEDEL
Partial D		Eurasian D clusterRHD-cE(5-7;226P)-D20082009
DCCRHD*42
RHD*DCC		CDePartial DEurasian D clusterRHD(A226D)20072012
DDNRHD*43
RHD*DDN		not reportedPartial DEurasian D clusterRHD(D164N)2008
DHQRHD*44
RHD*DHQ		not reportedPartial DEurasian D clusterRHD(H171Q)2004
DKKRHD*45
RHD*DKK		cDEPartial DEurasian D clusterRHD-RHCE(2-3)-RHD20002001
DLXRHD*46
RHD*DLX		cDEPartial DEurasian D clusterRHD(F223V)-RHCE(5:712-6)-RHD20122012
DMIRHD*47
RHD*DMI		CDePartial DEurasian D clusterRHD(M170I)20082009
DMI-1.1RHD*47.01
RHD*DMI-1.1		CDePartial DEurasian D clusterRHD(M170I)2010
DNSRHD*48
RHD*DNS		not reportedPartial DEurasian D clusterRHD(N162S)2006
DWNRHD*49
RHD*DWN		cDePartial DEurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20132013
RHD(A354T)RHD*50CDePartial DEurasian D clusterRHD(A354T)20142014
RHD(del44L)RHD*51not reportedPartial DEurasian D clusterRHD(130delCTC)20132014
weak D type 141RHD*52
RHD* 01W.141		cDePartial D
weakened D expression
weak D type		Eurasian D clusterRHD(F223S)20152016
RHD(IVS2-2delA)RHD*53
RHD*01EL.22		not reportedDEL
Partial D		Eurasian D clusterRHD(IVS2-2delA)2013
RHD(IVS4-2A>C)RHD*54cDEPartial DEurasian D clusterRHD(IVS4-2A>C)20142014
RHD(L81P)RHD*55not reportedweakened D expression
Partial D		Eurasian D clusterRHD(L81P)2009
DBARHD*56
RHD*DBA		not reportedweakened D expressionEurasian D clusterRHD(L227P)20032004
RHD-RHCE(7)-RHDRHD*58cDEPartial D
D category		Eurasian D clusterRHD-RHCE(7)-RHD2012
RHD(F175L)RHD*59not reportedPartial DEurasian D clusterRHD(F175L)20122012
RHD(60L,S230I)RHD*60not reportedEurasian D clusterRHD(I60L,S230I)
RHD(D164E)RHD*61not reportedPartial DEurasian D clusterRHD(D164E)
RHD(N152T,V270G)RHD*62not reportedEurasian D clusterRHD(N152T,V270G)2014
RHD deletionRHD*01N.01
cdeD negativeno RHDRHD(del exon 1 to 10)19911991
RHCE(1-9)-RHDRHD*01N.02cDED negativeEurasian D clusterRHCE(1-9)-RHD20012001
RHD-RHCe(2-9)-RHDRHD*01N.03CDeD negativeEurasian D clusterRHD-RHCe(2-9)-RHD19961996
RHD(S68T)-RHCe(3-9)-RHDRHD*01N.04CDeD negativeEurasian D clusterRHD(S68T)-RHCE(3-9)-RHD20052005
RHD-RHCe(2-7)-RHDRHD*01N.05CDeD negativeEurasian D clusterRHD-RHCE(3-7)-RHD20012001
Ccdes-2RHD*01N.06
CcdeD negativeDIVa clusterRHD-RHCE(4-7)-RHD(G336C)20092009
RHD-RHCE(4-7)-RHDRHD*01N.07cDED negative
DEL		Eurasian D clusterRHD-RHCE(4-7)-RHD19961996
RHD-RHCE(4-8)-RHDRHD*01N.07CDeD negativeEurasian D clusterRHD-RHCE(4-7)-RHD20052005
RHD-RHCE(4-7)-RHD1RHD*01N.07cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD-RHCE(4-7)-RHD2RHD*01N.07cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD(W16X)RHD*01N.08CDeD negativeEurasian D clusterRHD(W16X)20012001
RHD(Q41X)RHD*01N.09CDeD negativeEurasian D clusterRHD(Q41X)19971997
RHD(W90X)RHD*01N.10CDeD negativeEurasian D clusterRHD(W90X)20022002
RHD(325delA)RHD*01N.11CDeD negativeEurasian D clusterRHD(325del A)20072007
RHD(449del T)RHD*01N.12CDeD negativeEurasian D clusterRHD(449del T)2004
RHD(489delAGAC)RHD*01N.13CDeD negativeEurasian D clusterRHD(487del ACAG)19981998
RHD(W185X)RHD*01N.14CDeD negativeEurasian D clusterRHD(W185X)20052005
RHD(G212V)RHD*01N.15CDeD negativeEurasian D clusterRHD(G212V)20012001
RHD(711del C)RHD*01N.16cDED negativeEurasian D clusterRHD(711del C)20022002
RHD(652delA 653T>G)RHD*01N.17not reportedD negativeEurasian D clusterRHD(652delA 653T>G)2006
RHD(Y269X)RHD*01N.18CDeD negativeEurasian D clusterRHD(Y269X)20042009
RHD(Y311X)[933A]RHD*01N.19CDeD negativeEurasian D clusterRHD(Y311X)20052005
RHD(G314V)RHD*01N.20CDeD negativeEurasian D clusterRHD(G314V)19971997
RHD(Y330X)RHD*01N.21CDeD negativeEurasian D clusterRHD(Y330X)20012001
RHD(Y401X)RHD*01N.22
RHD*DEL17
RHD*01EL.17		cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD(343del C)RHD*01N.23CDeD negativeEurasian D clusterRHD(343del C)20042009
RHD(IVS2+1G>A)RHD*01N.24not reportedD negativeEurasian D clusterRHD(IVS2+1G>A)20072007
RHD(IVS2-1G>A)RHD*01N.25CDeD negativeEurasian D clusterRHD(IVS2-1G>A)20052005
RHD(IVS8+1G>A)RHD*01N.26CDeD negativeEurasian D clusterRHD(IVS8+1G>A)20012001
RHD(909ins TGGCT, IVS6+2del TAAG)RHD*01N.27CDeD negativeEurasian D clusterRHD(909ins TGGCT, IVS6+2del TAAG)20022002
RHD(970delCAC,976delTCCATCATGGGCTACA)RHD*01N.28CDeD negativeEurasian D clusterRHD(970delCAC,976delTCCATCATGGGCTACA)20082009
RHD(660delG)RHD*01N.29
RHD*660delG
RHD*01N.78		CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*745_757delRHD*01N.30not reportedD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA)
RHD(78delC)RHD*01N.32CDeD negativeEurasian D clusterRHD(78delC)20092010
RHD(712delG)RHD*01N.33CDeD negativeEurasian D clusterRHD(712delG)20082009
RHD(615delCA)RHD*01N.34CDeD negativeEurasian D clusterRHD(615delCA)20092012
RHD(330delGT)RHD*01N.35not reportedD negativeEurasian D clusterRHD(330delGT)20072007
RHD(1080del10)RHD*01N.36not reportedD negativeEurasian D clusterRHD(1080del10)2010
RHD(297del23)RHD*01N.37not reportedD negativeEurasian D clusterRHD(297del23)2013
RHD(IVS6+2T>A)RHD*01N.38not reportedD negativeEurasian D clusterRHD(IVS6+2T>A)2013
RHD(S256X)RHD*01N.39CDeD negativeEurasian D clusterRHD(S256X)20122013
RHD(Y343X)RHD*01N.40cDED negativeEurasian D clusterRHD(Y343X)20122013
RHD(361del11)RHD*01N.41CDeD negativeEurasian D clusterRHD(361del11)20142014
RHCE(1)-D(6)-CE(7-10)RHD*01N.42CdeD negativeno RHDRHCE(1)-RHD(6)-RHCE(7-10)20022002
RHCE(1-3)-RHD(4-10)RHD*01N.43cDED negativeEurasian D clusterRHD(Hybrid RHCE(1-3))20042009
RHD(1228-2del21)RHD*01N.44not reportedD negativeEurasian D clusterRHD(1228-2del21)2014
RHD(216dupCA,1195G>A)RHD*01N.45CDeD negativeEurasian D clusterRHD(216dupCA,1195G>A)2012
RHD(545delCTGT)RHD*01N.46cDeD negativeEurasian D clusterRHD(545delCTGT)20122012
RHD(745del13)RHD*01N.47CDeD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA,758TC>AG)2008
RHD(822delG)RHD*01N.48not reportedD negativeEurasian D clusterRHD(822delG)2014
RHD(915delC)RHD*01N.49not reportedD negativeEurasian D clusterRHD(915delC)20142014
RHD(950delA)RHD*01N.51not reportedD negativeEurasian D clusterRHD(950delA)2012
RHD(G385D)RHD*01N.53not reportedD negativeEurasian D clusterRHD(G385D)20142014
RHD(IVS5+1G>A)RHD*01N.54not reportedD negativeEurasian D clusterRHD(IVS5+1G>A)2012
RHD(IVS6+1G>A)RHD*01N.55CDeD negativeEurasian D clusterRHD(IVS6+1G>A)20142014
RHD(IVS7+2T>C)RHD*01N.56not reportedD negativeEurasian D clusterRHD(IVS7+2T>C)2012
RHD(IVS5-38del tctc)RHD*01N.58not reportedDELEurasian D clusterRHD(IVS5-38del tctc)20052005
RHD(Q200X)RHD*01N.59not reportedD negativeEurasian D clusterRHD(Q200X)2011
RHD(Q405X)RHD*01N.60not reportedD negativeEurasian D clusterRHD(Q405X)2015
RHD(R318X)RHD*01N.61CDeD negativeEurasian D clusterRHD(R318X)20082009
RHD(S254X)RHD*01N.62CDeD negativeEurasian D clusterRHD(S254X)20152015
RHD(Y311X)[761G]RHD*01N.63not reportedD negativeEurasian D clusterRHD(Y311X)
RHD(Q362X)RHD*01N.64not reportedD negativeEurasian D clusterRHD(Q362X)
RHD(124delAA)RHD*01N.65not reportedEurasian D clusterRHD(124delAA)
RHD(1174delA)RHD*01N.66not reportedEurasian D clusterRHD(1174delA)
RHD(delEx1)RHD*01N.67not reportedD negativeEurasian D clusterRHD(2-10)
RHD(S112I)RHD*01N.68not reportedEurasian D clusterRHD(S112I)2012
RHD(IVS4+1G>T,1136C>T)RHD*01N.69not reportedD negativeDAU clusterRHD(IVS4+1G>T,1136C>T)
RHD(IVS7+1G>T)RHD*01N.70not reportedD negativeEurasian D clusterRHD(IVS7+1G>T)
RHD(IVS7-1G>A)RHD*01N.71not reportedEurasian D clusterRHD(IVS7-1G>A)
RHD-RHCE(3)--weak D type 4.0RHD*01N.72not reportedD negativeweak D type 4 clusterRHD-RHCE(3)-RHD(T201R,F223V,819G>A)
RHD(T148R)RHD*01N.73
RHD*443G		not reportedD negativeEurasian D clusterRHD(T148R)20122012
RHD(142delM)RHD*01N.74
RHD*424_426delATG		not reportedD negativeEurasian D clusterRHD(142delM)
RHD(581insG)RHD*01N.75
RHD*581_582insG		not reportedEurasian D clusterRHD(581insG)
RHD(W393X)RHD*01N.76
RHD*1179A		not reportedEurasian D clusterRHD(W393X)20142014
RHD(IVS9-1G>A)RHD*01N.77
RHD*1228-1A		CDeEurasian D clusterRHD(IVS9-1G>A)20142014
RHD(L299P)RHD*01N.79
RHD*896C		not reportedEurasian D clusterRHD(L299P)2011
RHD(G336D)RHD*01N.80
RHD*1007A		not reportedD negativeEurasian D clusterRHD(G336D)2011
RHD(IVS7-2A>C)RHD*01N.81
RHD*1074-2C		not reportedEurasian D clusterRHD(IVS7-2A>C)2011
RHD(697delG)RHD*01N.82
RHD*697delG		not reportedD negativeEurasian D clusterRHD(697delG)
RHD(702delG)RHD*01N.83
RHD*702delG		not reportedD negativeEurasian D clusterRHD(702delG)2017
Ccdes-1RHD*03N.01
CcdeD negativeDIVa clusterRHD(L62F,A137V,N152T)-RHCE(4-7)-RHD(G336C)20042004
RHD psiRHD*08N.01
RHD*Pseudogene
cDeD negativeweak D type 4 clusterRHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)20002000
standard RHDRHD*01multipleD positive (apparently normal)Eurasian D clusterRHD
weak D type 1RHD*01W.1
RHD*weak D type 1		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V270G)19991999
weak D type 1.1RHD*01W.1.1
RHD*weak D type 1.1		CDeweak D type
weakened D expression		Eurasian D clusterRHD(L18V,V270G)20042005
weak D type 1.2RHD*01w.1.2
RHD*weak D type 1.2		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V238M,V270G)20142014
weak D type 2RHD*01W.2
RHD*weak D type 2		cDEweak D type
weakened D expression		Eurasian D clusterRHD(G385A)19991999
weak D type 2.1RHD*01W.2.1
RHD*weak D type 2.1		cDEweak D type
weakened D expression		Eurasian D clusterRHD(F101I,G385A)2009
weak D type 2.2RHD*01W.2.2
RHD*weak D type 2.2		cDEweak D type
weakened D expression		Eurasian D clusterRHD(V306I,Y311C,G385A)20142014
weak D type 3RHD*01W.3
RHD*weak D type 3		CDeweak D type
weakened D expression		Eurasian D clusterRHD(S3C)19991999
weak D type 3.1RHD*01W.3.1
RHD*weak D type 3.1		CDeweak D type
weakened D expression		Eurasian D clusterRHD(S3C,I60L)20142014
weak D type 5RHD*01W.5
RHD*weak D type 5		cDEweak D type
weakened D expression		Eurasian D clusterRHD(A149D)19991999
weak D type 6RHD*01W.6
RHD*weak D type 6		CDeweak D type
weakened D expression		Eurasian D clusterRHD(R10Q)19991999
weak D type 7RHD*01W.7
RHD*weak D type 7		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G339E)19991999
weak D type 8RHD*01W.8
RHD*weak D type 8		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G307R)19991999
weak D type 9RHD*01W.9
RHD*weak D type 9		cDEweak D type
weakened D expression		Eurasian D clusterRHD(A294P)19991999
weak D type 10RHD*01W.10
RHD*weak D type 10		cDEweak D type
weakened D expression		Eurasian D clusterRHD(W393R)19991999
weak D type 10.1RHD*01W.10.1
RHD*weak D type 10.1		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L382P,W393R)2016
weak D type 10.2RHD*01W.10.2
RHD*weak D type 10.2		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(W393R,K400T)20152016
weak D type 12RHD*01W.12
RHD*weak D type 12		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G277E)19991999
weak D type 13RHD*01W.13
RHD*weak D type 13		CDeweak D type
weakened D expression		Eurasian D clusterRHD(A276P)19991999
weak D type 14RHD*01W.14
RHD*weak D type 14		cDEweak D type
weakened D expression		Eurasian D clusterRHD(S182T,K198N,T201R)19991999
weak D type 16RHD*01W.16
RHD*weak D type 16		cDEweak D type
weakened D expression		Eurasian D clusterRHD(W220R)19991999
weak D type 17RHD*01W.17
RHD*weak D type 17		CDEweak D type
weakened D expression		Eurasian D clusterRHD(R114W)20002000
weak D type 18RHD*01W.18
RHD*weak D type 18		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(R7W)2000
weak D type 19RHD*01W.19
RHD*weak D type 19		cDeweak D type
weakened D expression		Eurasian D clusterRHD(I204T)20062006
weak D type 20RHD*01W.20
RHD*weak D type 20		cDEweak D typeEurasian D clusterRHD(F417S)20002006
weak D type 22RHD*01W.22
RHD*weak D type 22		CDeweak D type
weakened D expression		Eurasian D clusterRHD(W408C)2000
weak D type 23RHD*01W.23
RHD*weak D type 23		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(G212C)20012001
weak D type 24RHD*01W.24
RHD*weak D type 24		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L338P)20032003
weak D type 25RHD*01W.25
RHD*weak D type 25		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(R114Q)2005
weak D type 26RHD*01W.26
RHD*weak D type 26		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V9D)20042005
weak D type 27RHD*01W.27
RHD*weak D type 27		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(P221S)2002
weak D type 28RHD*01W.28
RHD*weak D type 28		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(1152A>C)2002
weak D type 29RHD*01W.29
RHD*weak D type 29		cDeweak D type
weakened D expression		weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,I342T)20032003
weak D type 30RHD*01W.30
RHD*weak D type 30		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(E340M)2003
weak D type 31RHD*01W.31
RHD*weak D type 31		CDeweak D type
weakened D expression		Eurasian D clusterRHD(P6L)20042005
weak D type 32RHD*01W.32
RHD*weak D type 32		CDeweak D type
weakened D expression		Eurasian D clusterRHD(I374N)20052005
weak D type 33RHD*01W.33
RHD*weak D type 33		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V174M)20032003
weak D type 34RHD*01W.34
RHD*weak D type 34		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(V270E)20032003
weak D type 35RHD*01W.35
RHD*weak D type 35		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(G87D)2003
weak D type 36RHD*01W.36
RHD*weak D type 36		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(V281G)2004
weak D type 37RHD*01W.37
RHD*weak D type 37		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(K133N)20032004
weak D type 38RHD*01W.38
RHD*weak D type 38		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G278D)20032004
weak D type 39RHD*01W.39
RHD*weak D type 39		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G339R)2003
weak D type 40RHD*01W.40
RHD*weak D type 40		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(T201R)2003
weak D type 41RHD*01W.41
RHD*weak D type 41		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(E398V)2004
weak D type 41.0.1RHD*01w.41.0.1
RHD*weak D type 41.01.		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L390L,E398V)2016
weak D type 42RHD*01W.42
RHD*weak D type 42		not reportedweak D type
weakened D expression
Partial D		Eurasian D clusterRHD(K409M)20052005
weak D type 43RHD*01W.43
RHD*weak D type 43		CDeweak D type
weakened D expression		Eurasian D clusterRHD(A202V)20062006
weak D type 44RHD*01W.44
RHD*weak D type 44		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(Y243C)2004
weak D type 45RHD*01W.45
RHD*weak D type 45		not reportedweak D type
weakened D expression
Partial D		Eurasian D clusterRHD(A399T)2004
weak D type 45.1RHD*01w.45.1
RHDÜweak D type 45.1		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(A273V,A399T)2010
weak D type 45.2RHD*01w.45.2
RHDÜweak D type 45.2		CDeweak D type
weakened D expression		Eurasian D clusterRHD(R70W,A273V,A399T)20132013
weak D type 46RHD*01W.46
RHD*weak D type 46		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(F407L)2004
weak D type 47RHD*01W.47
RHD*weak D type 47		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(R114G)2005
weak D type 48RHD*01W.48
RHD*weak D type 48		cDEweak D type
weakened D expression		Eurasian D clusterRHD(G61V)2005
weak D type 49RHD*01W.49
RHD*weak D type 49		CDeweak D type
weakened D expression		Eurasian D clusterRHD(S257F)20062007
weak D type 50RHD*01W.50
RHD*weak D type 50		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(Y243N)2006
weak D type 51RHD*01W.51
RHD*weak D type 51		not reportedweak D type
weakened D expression		Eurasian D clusterRHD-RHCE(4:594-4:602)-RHD2005
weak D type 52RHD*01W.52
RHD*weak D type 52		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(F31S)2005
weak D type 53RHD*01W.53
RHD*weak D type 53		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V247G)2005
weak D type 54RHD*01W.54
RHD*weak D type 54		cDEweak D type
weakened D expression		Eurasian D clusterRHD(S122L)
weak D type 55RHD*01W.55
RHD*weak D type 55		cDEweak D type
weakened D expression		Eurasian D clusterRHD(L299V)2007
weak D type 56RHD*01W.56
RHD*weak D type 56		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(A22E)20072007
weak D type 58RHD*01W.58
RHD*weak D type 58		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G336R)20072007
weak D type 59RHD*01W.59
RHD*weak D type 59		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L383P)20072007
weak D type 60RHD*01W.60
RHD*weak D type 60		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(407delFW)20072007
weak D type 61RHD*01W.61
RHD*weak D type 61		CDeweak D type
weakened D expression
DEL		Eurasian D clusterRHD(R10W)20062006
weak D type 62RHD*01W.62
RHD*weak D type 62		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(P221T)2006
weak D type 63RHD*01W.63
RHD*weak D type 63		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(I253N)2007
weak D type 64RHD*01W.64
RHD*weak D type 64		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(A294V)2007
weak D type 65RHD*01W.65
RHD*weak D type 65		cDeweak D type
weakened D expression		Eurasian D clusterRHD(A23D)2008
weak D type 66RHD*01W.66
RHD*weak D type 66		CDeweak D type
weakened D expression		Eurasian D clusterRHD(V306I)2007
weak D type 67RHD*01W.67
RHD*weak D type 67		cDEweak D type
weakened D expression		Eurasian D clusterRHD(T241I)2008
weak D type 68RHD*01W.68
RHD*weak D type 68		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(165C>T,1213C>G)2006
weak D type 69RHD*01W.69
RHD*weak D type 69		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(R318Q)2008
weak D type 70RHD*01W.70
RHD*weak D type 70		CDeweak D type
weakened D expression		Eurasian D clusterRHD(L338V)2008
weak D type 71RHD*01W.71
RHD*weak D type 71		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(R10P)2009
weak D type 72RHD*01W.72
RHD*weak D type 72		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(D404E)2007
weak D type 73RHD* 01W.73
RHD*weak D type 73		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(A414V)2009
weak D type 74RHD* 01W.74
RHD*weak D type 74
RHD(S68T)		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(S68T)2009
weak D type 75RHD* 01W.75
RHD*weak D type 75		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(E398D)2010
weak D type 76RHD* 01W.76
RHD*weak D type 76		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(Q405H)2010
weak D type 77RHD* 01W.77
RHD*weak D type 77		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(S256P)20102011
weak D type 78RHD* 01W.78
RHD*weak D type 78		CDeweakened D expression
weak D type		Eurasian D clusterRHD(F410V)20092011
weak D type 79RHD* 01W.79
RHD*weak D type 79		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L187P)2012
weak D type 80RHD* 01W.80
RHD*weak D type 80		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(G180E)2012
weak D type 81RHD* 01W.81
RHD*weak D type 81		CDeweak D type
weakened D expression		Eurasian D clusterRHD(K400T)2012
weak D type 82RHD* 01W.82
RHD*weak D type 82		CDeweak D type
weakened D expression		Eurasian D clusterRHD(A395V)2012
weak D type 84RHD* 01W.84
RHD*weak D type 84		CDeweak D type
weakened D expression		Eurasian D clusterRHD(S76N)2013
weak D type 85RHD* 01W.85
RHD*weak D type 85		CDeweak D type
weakened D expression		Eurasian D clusterRHD(R70Q)2010
weak D type 86RHD* 01W.86
RHD*weak D type 86		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(V345E)2014
weak D type 88RHD* 01W.88
RHD*weak D type 88		cDEweak D type
weakened D expression		Eurasian D clusterRHD(G61A)2014
weak D type 89RHD* 01W.89
RHD*weak D type 89		CDeweak D type
weakened D expression		Eurasian D clusterRHD(A23P)20142014
weak D type 90RHD* 01W.90
RHD*weak D type 90		CDeweak D type
weakened D expression		Eurasian D clusterRHD(N331K)20142014
weak D type 91RHD* 01W.91
RHD*weak D type 91		CDeweak D type
weakened D expression		Eurasian D clusterRHD(P396R)20142014
weak D type 92RHD* 01W.92
RHD*weak D type 92		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(L382P)20142014
weak D type 83RHD* 01W.83
RHD*weak D type 83		cDEweakened D expressionEurasian D clusterRHD(L413W)2012
weak D type 93RHD* 01W.93
RHD*weak D type 93		cDEweak D type
weakened D expression		Eurasian D clusterRHD(A120D)2016
weak D type 94RHD* 01W.94
RHD*weak D type 94
RHD*01EL.46		CDeweak D type
weakened D expression		Eurasian D clusterRHD(M295T)20122013
weak D type 95RHD* 01W.95
RHD*weak D type 95		cDEweak D type
weakened D expression		Eurasian D clusterRHD(A244P)20132013
weak D type 96RHD* 01W.96
RHD*weak D type 96		cDeweak D type
weakened D expression		Eurasian D clusterRHD(A244V)20132013
weak D type 87RHD* 01W.87
RHD*weak D type 87		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(I125N)20142015
weak D type 97RHD* 01W.97
RHD*weak D type 97		CDeweak D type
weakened D expression		Eurasian D clusterRHD(L181P)20132013
weak D type 98RHD* 01W.98
RHD*weak D type 98		cDEweak D type
weakened D expression		Eurasian D clusterRHD(T251P)20132013
weak D type 99RHD* 01W.99
RHD*weak D type 99		CDeweak D type
weakened D expression		Eurasian D clusterRHD(E369D)20132013
weak D type 100RHD* 01W.100
RHD*weak D type 100		CDeweak D type
weakened D expression		Eurasian D clusterRHD(G263R)2010
weak D type 101RHD* 01W.101
RHD*weak D type 101		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(E21A)2015
weak D type 102RHD* 01W.102
RHD*weak D type 102		multipleweakened D expression
weak D type		Eurasian D clusterRHD(I25F)2016
weak D type 103RHD* 01W.103
RHD*weak D type 103		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(F31I)2015
RHD(D53Y)RHD* 01W.104
RHD*weak D type 104		not reportedweakened D expressionEurasian D clusterRHD(D53Y)2015
weak D type 105RHD* 01W.105
RHD*weak D type 105		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(S67W)20152015
weak D type 106RHD* 01W.106
RHD*weak D type 106		cDEweak D type
weakened D expression		Eurasian D clusterRHD(W74G)20152015
weak D type 107RHD* 01W.107
RHD*weak D type 107		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(S75C)2015
RHD(G96D)RHD* 01W.108
RHD*weak D type 108		not reportedweakened D expressionEurasian D clusterRHD(G96D)20152015
weak D type 109RHD* 01W.109
RHD*weak D type 109		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(S126P)2015
weak D type 110RHD* 01W.110
RHD*weak D type 110		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(Q138R)20152015
weak D type 111RHD* 01W.111
RHD*weak D type 111		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(G212S)2015
weak D type 112RHD* 01W.112
RHD*weak D type 112		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(G212D)20152015
weak D type 113RHD* 01W.113
RHD*weak D type 113		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(W292R)2015
weak D type 114RHD* 01W.114
RHD*weak D type 114		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(P323L)20152015
weak D type 115RHD* 01W.115
RHD*weak D type 115		CDeweakened D expression
weak D type		Eurasian D clusterRHD(M328K)20152015
weak D type 116RHD* 01W.116
RHD*weak D type 116		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(A116P)20152015
weak D type 117RHD* 01W.117
RHD*weak D type 117		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(A116T)2015
weak D type 118RHD* 01W.118
RHD*weak D type 118		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(A116V)2010
weak D type 119RHD* 01W.119
RHD*weak D type 119		CDeweakened D expression
weak D type		Eurasian D clusterRHD(A273V)2010
weak D type 120RHD* 01W.120
RHD*weak D type 120		CDeweakened D expression
weak D type		Eurasian D clusterRHD(A273E)2010
weak D type 121RHD* 01W.121
RHD*weak D type 121		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(A59D)2015
weak D type 122RHD* 01W.122
RHD*weak D type 122		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(R70W)2011
weak D type 123RHD* 01W.123
RHD*weak D type 123		not reportedweakened D expression
weakened D expression		Eurasian D clusterRHD(V127L)2015
weak D type 124RHD* 01W.124
RHD*weak D type 124		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(K198N)2015
weak D type 125RHD* 01W.125
RHD*weak D type 125		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(N224S)2015
weak D type 126RHD* 01W.126
RHD*weak D type 126		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(K400I)2015
weak D type 127RHD* 01W.127
RHD*weak D type 127		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(K400N)20122012
weak D type 128RHD* 01W.128
RHD*weak D type 128		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(D403Y)2015
weak D type 129RHD* 01W.129
RHD*weak D type 129		CDeweakened D expression
weak D type		Eurasian D clusterRHD(D403V)20122012
weak D type 130RHD* 01W.130
RHD*weak D type 130		CDeweakened D expression
weak D type		Eurasian D clusterRHD(T55P)20112012
weak D type 131RHD* 01W.131
RHD*weak D type 131		CDeweakened D expression
weak D type		Eurasian D clusterRHD(A85G)20122012
weak D type 132RHD* 01W.132
RHD*weak D type 132		CDeweakened D expression
weak D type		Eurasian D clusterRHD(G132R)20102012
weak D type 133RHD* 01W.133
RHD*weak D type 133		CDeweakened D expression
weak D type		Eurasian D clusterRHD(G132E)20122012
weak D type 134RHD* 01W.134
RHD*weak D type 134		not reportedweak D typeEurasian D clusterRHD(L390V)20122012
weak D type 135RHD* 01W.135
RHD*weak D type 135		not reportedweak D type
weakened D expression		Eurasian D clusterRHD(M295K)2016
weak D type 136RHD* 01W.136
RHD*weak D type 136		not reportedweak D typeEurasian D clusterRHD(P14L)2016
weak D type 137RHD* 01W.137
RHD*weak D type 137		not reported
weak D type		Eurasian D clusterRHD(H260Q)2016
weak D type 138RHD* 01W.138
RHD*weak D type 138		not reportedweak D typeEurasian D clusterRHD(P291S)2016
weak D type 139RHD* 01W.139
RHD*weak D type 139		not reported
weak D type		Eurasian D clusterRHD(L390P)2016
weak D type 140RHD* 01W.140
RHD*weak D type 140		not reportedweakened D expression
weak D type		Eurasian D clusterRHD(F410S)20162016
weak D type 143RHD* 01W.143
RHD*weak D type 143		CDeweakened D expression
weak D type		Eurasian D clusterRHD(A58V)2015
weak D type 144RHD* 01W.144
RHD*weak D type 144		CDeweakened D expression
weak D type		Eurasian D clusterRHD(E193D)2016
weak D type 145RHD* 01W.145
RHD*weak D type 145		not reportedEurasian D clusterRHD(P14R)