Note: There are up to three proposed ISBT designations per allele, therefore alleles may appear repeatedly in this list
| ISBT name | Designation | Haplotype | Phenotype | Cluster | Structure | First mention | Definitive publication |
| RHD(S68T) | weak D type 74 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(S68T) | 2009 | |
| RHD* 01W.100 | weak D type 100 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G263R) | 2010 | |
| RHD* 01W.101 | weak D type 101 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(E21A) | 2015 | |
| RHD* 01W.102 | weak D type 102 | multiple | weakened D expression weak D type | Eurasian D cluster | RHD(I25F) | 2016 | |
| RHD* 01W.103 | weak D type 103 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(F31I) | 2015 | |
| RHD* 01W.104 | RHD(D53Y) | not reported | weakened D expression | Eurasian D cluster | RHD(D53Y) | 2015 | |
| RHD* 01W.105 | weak D type 105 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(S67W) | 2015 | 2015 |
| RHD* 01W.106 | weak D type 106 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W74G) | 2015 | 2015 |
| RHD* 01W.107 | weak D type 107 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S75C) | 2015 | |
| RHD* 01W.108 | RHD(G96D) | not reported | weakened D expression | Eurasian D cluster | RHD(G96D) | 2015 | 2015 |
| RHD* 01W.109 | weak D type 109 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S126P) | 2015 | |
| RHD* 01W.110 | weak D type 110 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(Q138R) | 2015 | 2015 |
| RHD* 01W.111 | weak D type 111 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(G212S) | 2015 | |
| RHD* 01W.112 | weak D type 112 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(G212D) | 2015 | 2015 |
| RHD* 01W.113 | weak D type 113 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(W292R) | 2015 | |
| RHD* 01W.114 | weak D type 114 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(P323L) | 2015 | 2015 |
| RHD* 01W.115 | weak D type 115 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(M328K) | 2015 | 2015 |
| RHD* 01W.116 | weak D type 116 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116P) | 2015 | 2015 |
| RHD* 01W.117 | weak D type 117 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116T) | 2015 | |
| RHD* 01W.118 | weak D type 118 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116V) | 2010 | |
| RHD* 01W.119 | weak D type 119 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A273V) | 2010 | |
| RHD* 01W.120 | weak D type 120 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A273E) | 2010 | |
| RHD* 01W.121 | weak D type 121 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A59D) | 2015 | |
| RHD* 01W.122 | weak D type 122 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(R70W) | 2011 | |
| RHD* 01W.123 | weak D type 123 | not reported | weakened D expression weakened D expression | Eurasian D cluster | RHD(V127L) | 2015 | |
| RHD* 01W.124 | weak D type 124 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(K198N) | 2015 | |
| RHD* 01W.125 | weak D type 125 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(N224S) | 2015 | |
| RHD* 01W.126 | weak D type 126 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(K400I) | 2015 | |
| RHD* 01W.127 | weak D type 127 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(K400N) | 2012 | 2012 |
| RHD* 01W.128 | weak D type 128 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(D403Y) | 2015 | |
| RHD* 01W.129 | weak D type 129 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(D403V) | 2012 | 2012 |
| RHD* 01W.130 | weak D type 130 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(T55P) | 2011 | 2012 |
| RHD* 01W.131 | weak D type 131 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A85G) | 2012 | 2012 |
| RHD* 01W.132 | weak D type 132 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(G132R) | 2010 | 2012 |
| RHD* 01W.133 | weak D type 133 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(G132E) | 2012 | 2012 |
| RHD* 01W.134 | weak D type 134 | not reported | weak D type | Eurasian D cluster | RHD(L390V) | 2012 | 2012 |
| RHD* 01W.135 | weak D type 135 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(M295K) | 2016 | |
| RHD* 01W.136 | weak D type 136 | not reported | weak D type | Eurasian D cluster | RHD(P14L) | 2016 | |
| RHD* 01W.137 | weak D type 137 | not reported | weak D type | Eurasian D cluster | RHD(H260Q) | 2016 | |
| RHD* 01W.138 | weak D type 138 | not reported | weak D type | Eurasian D cluster | RHD(P291S) | 2016 | |
| RHD* 01W.139 | weak D type 139 | not reported | weak D type | Eurasian D cluster | RHD(L390P) | 2016 | |
| RHD* 01W.140 | weak D type 140 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(F410S) | 2016 | 2016 |
| RHD* 01W.141 | weak D type 141 | cDe | Partial D weakened D expression weak D type | Eurasian D cluster | RHD(F223S) | 2015 | 2016 |
| RHD* 01W.142 | weak D type 142 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A23S) | 2016 | |
| RHD* 01W.143 | weak D type 143 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A58V) | 2015 | |
| RHD* 01W.144 | weak D type 144 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(E193D) | 2016 | |
| RHD* 01W.145 | weak D type 145 | not reported | Eurasian D cluster | RHD(P14R) | |||
| RHD* 01W.73 | weak D type 73 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A414V) | 2009 | |
| RHD* 01W.74 | weak D type 74 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(S68T) | 2009 | |
| RHD* 01W.75 | weak D type 75 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E398D) | 2010 | |
| RHD* 01W.76 | weak D type 76 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Q405H) | 2010 | |
| RHD* 01W.77 | weak D type 77 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S256P) | 2010 | 2011 |
| RHD* 01W.78 | weak D type 78 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(F410V) | 2009 | 2011 |
| RHD* 01W.79 | weak D type 79 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L187P) | 2012 | |
| RHD* 01W.80 | weak D type 80 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G180E) | 2012 | |
| RHD* 01W.81 | weak D type 81 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(K400T) | 2012 | |
| RHD* 01W.82 | weak D type 82 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A395V) | 2012 | |
| RHD* 01W.83 | weak D type 83 | cDE | weakened D expression | Eurasian D cluster | RHD(L413W) | 2012 | |
| RHD* 01W.84 | weak D type 84 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S76N) | 2013 | |
| RHD* 01W.85 | weak D type 85 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R70Q) | 2010 | |
| RHD* 01W.86 | weak D type 86 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V345E) | 2014 | |
| RHD* 01W.87 | weak D type 87 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(I125N) | 2014 | 2015 |
| RHD* 01W.88 | weak D type 88 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G61A) | 2014 | |
| RHD* 01W.89 | weak D type 89 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A23P) | 2014 | 2014 |
| RHD* 01W.90 | weak D type 90 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(N331K) | 2014 | 2014 |
| RHD* 01W.91 | weak D type 91 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(P396R) | 2014 | 2014 |
| RHD* 01W.92 | weak D type 92 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L382P) | 2014 | 2014 |
| RHD* 01W.93 | weak D type 93 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A120D) | 2016 | |
| RHD* 01W.94 | weak D type 94 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(M295T) | 2012 | 2013 |
| RHD* 01W.95 | weak D type 95 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A244P) | 2013 | 2013 |
| RHD* 01W.96 | weak D type 96 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(A244V) | 2013 | 2013 |
| RHD* 01W.97 | weak D type 97 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L181P) | 2013 | 2013 |
| RHD* 01W.98 | weak D type 98 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(T251P) | 2013 | 2013 |
| RHD* 01W.99 | weak D type 99 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(E369D) | 2013 | 2013 |
| RHD* DIV.3 | DIV type 3 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(6-9)-RHD | 1999 | 1999 |
| RHD* DIVb | DIVb type 2 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(7:1048-9)-RHD | 1995 | 1995 |
| RHD*01 | standard RHD | multiple | D positive (apparently normal) | Eurasian D cluster | RHD | ||
| RHD*01.01 | DUC-3 | CDe | D positive (apparently normal) | Eurasian D cluster | RHD(W16C) | 2010 | |
| RHD*01EL.01 | RHD(1227G>A) | CDe | DEL | Eurasian D cluster | RHD(1227G>A) | 2001 | 2001 |
| RHD*01EL.02 | RHD(M1I) | not reported | DEL | Eurasian D cluster | RHD(M1I) | 2006 | 2006 |
| RHD*01EL.03 | RHD(L18P) | not reported | DEL | Eurasian D cluster | RHD(L18P) | 2006 | 2006 |
| RHD*01EL.04 | RHD(147del A) | CDe | DEL | Eurasian D cluster | RHD(147del A) | 2004 | 2009 |
| RHD*01EL.05 | RHD(IVS1+1G>A) | not reported | DEL | Eurasian D cluster | RHD(IVS1+1G>A) | 2001 | |
| RHD*01EL.06 | RHD(L84P) | not reported | DEL | Eurasian D cluster | RHD(L84P) | 2006 | 2006 |
| RHD*01EL.07 | RHD(A137E) | CDe | DEL | Eurasian D cluster | RHD(A137E) | 2006 | 2009 |
| RHD*01EL.08 | RHD(IVS3+1G>A) | CDe | DEL D negative | Eurasian D cluster | RHD(IVS3+1G>A) | 2001 | 2001 |
| RHD*01EL.09 | RHD(IVS3+2T>A) | cDE | D negative | Eurasian D cluster | RHD(IVS3+2T>A) | 2008 | 2009 |
| RHD*01EL.10 | RHD(W408R) | CDe | DEL | Eurasian D cluster | RHD(W408R) | 2005 | 2005 |
| RHD*01EL.11 | RHD(X418L) | CDe | DEL | Eurasian D cluster | RHD(X418L) | 2005 | 2005 |
| RHD*01EL.12 | RHD(L153P) | cDE | DEL | Eurasian D cluster | RHD(L153P) | 2004 | 2009 |
| RHD*01EL.13 | RHD(786del A) | CDe | D negative | Eurasian D cluster | RHD(785del A) | 2004 | 2009 |
| RHD*01EL.14 | RHD(IVS4+5G>T) | CDe | weakened D expression | Eurasian D cluster | RHD(IVS4+5G>T) | 2010 | 2013 |
| RHD*01EL.15 | RHD(G308X) | CDe | D negative | Eurasian D cluster | RHD(G308X) | 2010 | |
| RHD*01EL.16 | RHD(G212R) | cDe | DEL | Eurasian D cluster | RHD(G212R) | 2008 | 2009 |
| RHD*01EL.17 | RHD(Y401X) | cDE | D negative | Eurasian D cluster | RHD(Y401X) | 2004 | 2005 |
| RHD*01EL.18 | RHD(93insT) | CDe | DEL D negative | Eurasian D cluster | RHD(93dupT) | 2008 | 2008 |
| RHD*01EL.19 | RHD(IVS4-2A>G) | not reported | weakened D expression | Eurasian D cluster | RHD(IVS4-2A>G) | 2010 | 2011 |
| RHD*01EL.20 | RHD(IVS8-8T>A) | not reported | weakened D expression | Eurasian D cluster | RHD(IVS8-8T>A) | 2007 | 2007 |
| RHD*01EL.21 | RHD(IVS1+5G>C) | not reported | DEL | Eurasian D cluster | RHD(IVS1+5G>C) | 2013 | |
| RHD*01EL.22 | RHD(IVS2-2delA) | not reported | DEL Partial D | Eurasian D cluster | RHD(IVS2-2delA) | 2013 | |
| RHD*01EL.23 | DBU | cDE | DEL Partial D | Eurasian D cluster | RHD-cE(5-7;226P)-D | 2008 | 2009 |
| RHD*01EL.24 | DEL RHD(A280T) | not reported | DEL | Eurasian D cluster | RHD(A280T) | 2014 | 2014 |
| RHD*01EL.25 | DEL RHD(X418K) | CDe | DEL | Eurasian D cluster | RHD(X418K) | 2015 | 2015 |
| RHD*01EL.26 | RHD(1248insG) | CDe | DEL | Eurasian D cluster | RHD(1248insG) | 2014 | 2014 |
| RHD*01EL.28 | RHD(993delC) | not reported | Eurasian D cluster | RHD(993delC) | 2014 | ||
| RHD*01EL.29 | RHD(D404H) | cDE | DEL | Eurasian D cluster | RHD(D404H) | 2012 | |
| RHD*01EL.30 | RHD(del Ex8) | not reported | DEL | Eurasian D cluster | RHD(del Ex8) | 2007 | 2007 |
| RHD*01EL.31 | RHD(IVS1+1G>T) | cDE | DEL | Eurasian D cluster | RHD(1481G>T) | 2014 | 2014 |
| RHD*01EL.32 | RHD(IVS1-29G>C) | CDe | DEL | Eurasian D cluster | RHD(IVS1-29G>C) | 2012 | |
| RHD*01EL.33 | RHD(IVS2-2A>G) | not reported | DEL | Eurasian D cluster | RHD(IVS2-2A>G) | 2011 | 2011 |
| RHD*01EL.36 | RHD(IVS7+152C>A,1227G>A) | CDe | DEL | Eurasian D cluster | RHD(IVS7+152C>A,1227G>A) | 2002 | 2002 |
| RHD*01EL.37 | RHD(IVS8-31C>T) | not reported | DEL | Eurasian D cluster | RHD(IVS8-31C>T) | 2012 | |
| RHD*01EL.38 | RHD(L337R) | CDe | D negative DEL | Eurasian D cluster | RHD(L337R) | 2014 | 2014 |
| RHD*01EL.39 | RHD(L38X) | not reported | DEL | Eurasian D cluster | RHD(L38X) | 2010 | |
| RHD*01EL.40 | RHD(L93R) | CDe | DEL | Eurasian D cluster | RHD(L93R) | 2014 | 2014 |
| RHD*01EL.41 | RHD(P291R) | CDe | DEL | Eurasian D cluster | RHD(P291R) | 2012 | |
| RHD*01EL.42 | RHD(S112T) | not reported | DEL | Eurasian D cluster | RHD(S112T) | 2012 | |
| RHD*01EL.43 | RHD(W16R) | cDE | DEL | Eurasian D cluster | RHD(W16R) | 2012 | |
| RHD*01EL.44 | RHD-RHCE(4-9)-RHD | CDe | DEL | Eurasian D cluster | RHD-RHCE(4-9)-RHD | 2009 | 2009 |
| RHD*01EL.45 | RHD(T241P) | not reported | Eurasian D cluster | RHD(T241P) | |||
| RHD*01EL.46 | weak D type 94 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(M295T) | 2012 | 2013 |
| RHD*01N.01 | RHD deletion | cde | D negative | no RHD | RHD(del exon 1 to 10) | 1991 | 1991 |
| RHD*01N.02 | RHCE(1-9)-RHD | cDE | D negative | Eurasian D cluster | RHCE(1-9)-RHD | 2001 | 2001 |
| RHD*01N.03 | RHD-RHCe(2-9)-RHD | CDe | D negative | Eurasian D cluster | RHD-RHCe(2-9)-RHD | 1996 | 1996 |
| RHD*01N.04 | RHD(S68T)-RHCe(3-9)-RHD | CDe | D negative | Eurasian D cluster | RHD(S68T)-RHCE(3-9)-RHD | 2005 | 2005 |
| RHD*01N.05 | RHD-RHCe(2-7)-RHD | CDe | D negative | Eurasian D cluster | RHD-RHCE(3-7)-RHD | 2001 | 2001 |
| RHD*01N.06 | Ccdes-2 | Ccde | D negative | DIVa cluster | RHD-RHCE(4-7)-RHD(G336C) | 2009 | 2009 |
| RHD*01N.07 | RHD-RHCE(4-7)-RHD | cDE | D negative DEL | Eurasian D cluster | RHD-RHCE(4-7)-RHD | 1996 | 1996 |
| RHD*01N.07 | RHD-RHCE(4-7)-RHD1 | cDE | D negative | Eurasian D cluster | RHD-RHCE(4-7)-RHD | ||
| RHD*01N.07 | RHD-RHCE(4-7)-RHD2 | cDE | D negative | Eurasian D cluster | RHD-RHCE(4-7)-RHD | ||
| RHD*01N.07 | RHD-RHCE(4-8)-RHD | CDe | D negative | Eurasian D cluster | RHD-RHCE(4-7)-RHD | 2005 | 2005 |
| RHD*01N.08 | RHD(W16X) | CDe | D negative | Eurasian D cluster | RHD(W16X) | 2001 | 2001 |
| RHD*01N.09 | RHD(Q41X) | CDe | D negative | Eurasian D cluster | RHD(Q41X) | 1997 | 1997 |
| RHD*01N.10 | RHD(W90X) | CDe | D negative | Eurasian D cluster | RHD(W90X) | 2002 | 2002 |
| RHD*01N.11 | RHD(325delA) | CDe | D negative | Eurasian D cluster | RHD(325del A) | 2007 | 2007 |
| RHD*01N.12 | RHD(449del T) | CDe | D negative | Eurasian D cluster | RHD(449del T) | 2004 | |
| RHD*01N.13 | RHD(489delAGAC) | CDe | D negative | Eurasian D cluster | RHD(487del ACAG) | 1998 | 1998 |
| RHD*01N.14 | RHD(W185X) | CDe | D negative | Eurasian D cluster | RHD(W185X) | 2005 | 2005 |
| RHD*01N.15 | RHD(G212V) | CDe | D negative | Eurasian D cluster | RHD(G212V) | 2001 | 2001 |
| RHD*01N.16 | RHD(711del C) | cDE | D negative | Eurasian D cluster | RHD(711del C) | 2002 | 2002 |
| RHD*01N.17 | RHD(652delA 653T>G) | not reported | D negative | Eurasian D cluster | RHD(652delA 653T>G) | 2006 | |
| RHD*01N.18 | RHD(Y269X) | CDe | D negative | Eurasian D cluster | RHD(Y269X) | 2004 | 2009 |
| RHD*01N.19 | RHD(Y311X)[933A] | CDe | D negative | Eurasian D cluster | RHD(Y311X) | 2005 | 2005 |
| RHD*01N.20 | RHD(G314V) | CDe | D negative | Eurasian D cluster | RHD(G314V) | 1997 | 1997 |
| RHD*01N.21 | RHD(Y330X) | CDe | D negative | Eurasian D cluster | RHD(Y330X) | 2001 | 2001 |
| RHD*01N.22 | RHD(Y401X) | cDE | D negative | Eurasian D cluster | RHD(Y401X) | 2004 | 2005 |
| RHD*01N.23 | RHD(343del C) | CDe | D negative | Eurasian D cluster | RHD(343del C) | 2004 | 2009 |
| RHD*01N.24 | RHD(IVS2+1G>A) | not reported | D negative | Eurasian D cluster | RHD(IVS2+1G>A) | 2007 | 2007 |
| RHD*01N.25 | RHD(IVS2-1G>A) | CDe | D negative | Eurasian D cluster | RHD(IVS2-1G>A) | 2005 | 2005 |
| RHD*01N.26 | RHD(IVS8+1G>A) | CDe | D negative | Eurasian D cluster | RHD(IVS8+1G>A) | 2001 | 2001 |
| RHD*01N.27 | RHD(909ins TGGCT, IVS6+2del TAAG) | CDe | D negative | Eurasian D cluster | RHD(909ins TGGCT, IVS6+2del TAAG) | 2002 | 2002 |
| RHD*01N.28 | RHD(970delCAC,976delTCCATCATGGGCTACA) | CDe | D negative | Eurasian D cluster | RHD(970delCAC,976delTCCATCATGGGCTACA) | 2008 | 2009 |
| RHD*01N.29 | RHD(660delG) | CDe | D negative | Eurasian D cluster | RHD(660delG) | 2008 | 2009 |
| RHD*01N.30 | RHD*745_757del | not reported | D negative | Eurasian D cluster | RHD(745delGTGGTGACAGCCA) | ||
| RHD*01N.32 | RHD(78delC) | CDe | D negative | Eurasian D cluster | RHD(78delC) | 2009 | 2010 |
| RHD*01N.33 | RHD(712delG) | CDe | D negative | Eurasian D cluster | RHD(712delG) | 2008 | 2009 |
| RHD*01N.34 | RHD(615delCA) | CDe | D negative | Eurasian D cluster | RHD(615delCA) | 2009 | 2012 |
| RHD*01N.35 | RHD(330delGT) | not reported | D negative | Eurasian D cluster | RHD(330delGT) | 2007 | 2007 |
| RHD*01N.36 | RHD(1080del10) | not reported | D negative | Eurasian D cluster | RHD(1080del10) | 2010 | |
| RHD*01N.37 | RHD(297del23) | not reported | D negative | Eurasian D cluster | RHD(297del23) | 2013 | |
| RHD*01N.38 | RHD(IVS6+2T>A) | not reported | D negative | Eurasian D cluster | RHD(IVS6+2T>A) | 2013 | |
| RHD*01N.39 | RHD(S256X) | CDe | D negative | Eurasian D cluster | RHD(S256X) | 2012 | 2013 |
| RHD*01N.40 | RHD(Y343X) | cDE | D negative | Eurasian D cluster | RHD(Y343X) | 2012 | 2013 |
| RHD*01N.41 | RHD(361del11) | CDe | D negative | Eurasian D cluster | RHD(361del11) | 2014 | 2014 |
| RHD*01N.42 | RHCE(1)-D(6)-CE(7-10) | Cde | D negative | no RHD | RHCE(1)-RHD(6)-RHCE(7-10) | 2002 | 2002 |
| RHD*01N.43 | RHCE(1-3)-RHD(4-10) | cDE | D negative | Eurasian D cluster | RHD(Hybrid RHCE(1-3)) | 2004 | 2009 |
| RHD*01N.44 | RHD(1228-2del21) | not reported | D negative | Eurasian D cluster | RHD(1228-2del21) | 2014 | |
| RHD*01N.45 | RHD(216dupCA,1195G>A) | CDe | D negative | Eurasian D cluster | RHD(216dupCA,1195G>A) | 2012 | |
| RHD*01N.46 | RHD(545delCTGT) | cDe | D negative | Eurasian D cluster | RHD(545delCTGT) | 2012 | 2012 |
| RHD*01N.47 | RHD(745del13) | CDe | D negative | Eurasian D cluster | RHD(745delGTGGTGACAGCCA,758TC>AG) | 2008 | |
| RHD*01N.48 | RHD(822delG) | not reported | D negative | Eurasian D cluster | RHD(822delG) | 2014 | |
| RHD*01N.49 | RHD(915delC) | not reported | D negative | Eurasian D cluster | RHD(915delC) | 2014 | 2014 |
| RHD*01N.50 | RHD(93insT) | CDe | DEL D negative | Eurasian D cluster | RHD(93dupT) | 2008 | 2008 |
| RHD*01N.51 | RHD(950delA) | not reported | D negative | Eurasian D cluster | RHD(950delA) | 2012 | |
| RHD*01N.52 | RHD(G308X) | CDe | D negative | Eurasian D cluster | RHD(G308X) | 2010 | |
| RHD*01N.53 | RHD(G385D) | not reported | D negative | Eurasian D cluster | RHD(G385D) | 2014 | 2014 |
| RHD*01N.54 | RHD(IVS5+1G>A) | not reported | D negative | Eurasian D cluster | RHD(IVS5+1G>A) | 2012 | |
| RHD*01N.55 | RHD(IVS6+1G>A) | CDe | D negative | Eurasian D cluster | RHD(IVS6+1G>A) | 2014 | 2014 |
| RHD*01N.56 | RHD(IVS7+2T>C) | not reported | D negative | Eurasian D cluster | RHD(IVS7+2T>C) | 2012 | |
| RHD*01N.57 | RHD(L337R) | CDe | D negative DEL | Eurasian D cluster | RHD(L337R) | 2014 | 2014 |
| RHD*01N.58 | RHD(IVS5-38del tctc) | not reported | DEL | Eurasian D cluster | RHD(IVS5-38del tctc) | 2005 | 2005 |
| RHD*01N.59 | RHD(Q200X) | not reported | D negative | Eurasian D cluster | RHD(Q200X) | 2011 | |
| RHD*01N.60 | RHD(Q405X) | not reported | D negative | Eurasian D cluster | RHD(Q405X) | 2015 | |
| RHD*01N.61 | RHD(R318X) | CDe | D negative | Eurasian D cluster | RHD(R318X) | 2008 | 2009 |
| RHD*01N.62 | RHD(S254X) | CDe | D negative | Eurasian D cluster | RHD(S254X) | 2015 | 2015 |
| RHD*01N.63 | RHD(Y311X)[761G] | not reported | D negative | Eurasian D cluster | RHD(Y311X) | ||
| RHD*01N.64 | RHD(Q362X) | not reported | D negative | Eurasian D cluster | RHD(Q362X) | ||
| RHD*01N.65 | RHD(124delAA) | not reported | Eurasian D cluster | RHD(124delAA) | |||
| RHD*01N.66 | RHD(1174delA) | not reported | Eurasian D cluster | RHD(1174delA) | |||
| RHD*01N.67 | RHD(delEx1) | not reported | D negative | Eurasian D cluster | RHD(2-10) | ||
| RHD*01N.68 | RHD(S112I) | not reported | Eurasian D cluster | RHD(S112I) | 2012 | ||
| RHD*01N.69 | RHD(IVS4+1G>T,1136C>T) | not reported | D negative | DAU cluster | RHD(IVS4+1G>T,1136C>T) | ||
| RHD*01N.70 | RHD(IVS7+1G>T) | not reported | D negative | Eurasian D cluster | RHD(IVS7+1G>T) | ||
| RHD*01N.71 | RHD(IVS7-1G>A) | not reported | Eurasian D cluster | RHD(IVS7-1G>A) | |||
| RHD*01N.72 | RHD-RHCE(3)--weak D type 4.0 | not reported | D negative | weak D type 4 cluster | RHD-RHCE(3)-RHD(T201R,F223V,819G>A) | ||
| RHD*01N.73 | RHD(T148R) | not reported | D negative | Eurasian D cluster | RHD(T148R) | 2012 | 2012 |
| RHD*01N.74 | RHD(142delM) | not reported | D negative | Eurasian D cluster | RHD(142delM) | ||
| RHD*01N.75 | RHD(581insG) | not reported | Eurasian D cluster | RHD(581insG) | |||
| RHD*01N.76 | RHD(W393X) | not reported | Eurasian D cluster | RHD(W393X) | 2014 | 2014 | |
| RHD*01N.77 | RHD(IVS9-1G>A) | CDe | Eurasian D cluster | RHD(IVS9-1G>A) | 2014 | 2014 | |
| RHD*01N.78 | RHD(660delG) | CDe | D negative | Eurasian D cluster | RHD(660delG) | 2008 | 2009 |
| RHD*01N.79 | RHD(L299P) | not reported | Eurasian D cluster | RHD(L299P) | 2011 | ||
| RHD*01N.80 | RHD(G336D) | not reported | D negative | Eurasian D cluster | RHD(G336D) | 2011 | |
| RHD*01N.81 | RHD(IVS7-2A>C) | not reported | Eurasian D cluster | RHD(IVS7-2A>C) | 2011 | ||
| RHD*01N.82 | RHD(697delG) | not reported | D negative | Eurasian D cluster | RHD(697delG) | ||
| RHD*01N.83 | RHD(702delG) | not reported | D negative | Eurasian D cluster | RHD(702delG) | 2017 | |
| RHD*01W.1 | weak D type 1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V270G) | 1999 | 1999 |
| RHD*01W.1.1 | weak D type 1.1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L18V,V270G) | 2004 | 2005 |
| RHD*01W.10 | weak D type 10 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W393R) | 1999 | 1999 |
| RHD*01W.10.1 | weak D type 10.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L382P,W393R) | 2016 | |
| RHD*01W.10.2 | weak D type 10.2 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(W393R,K400T) | 2015 | 2016 |
| RHD*01W.12 | weak D type 12 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G277E) | 1999 | 1999 |
| RHD*01W.13 | weak D type 13 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A276P) | 1999 | 1999 |
| RHD*01W.14 | weak D type 14 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(S182T,K198N,T201R) | 1999 | 1999 |
| RHD*01W.16 | weak D type 16 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W220R) | 1999 | 1999 |
| RHD*01W.17 | weak D type 17 | CDE | weak D type weakened D expression | Eurasian D cluster | RHD(R114W) | 2000 | 2000 |
| RHD*01W.18 | weak D type 18 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R7W) | 2000 | |
| RHD*01W.19 | weak D type 19 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(I204T) | 2006 | 2006 |
| RHD*01W.2 | weak D type 2 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G385A) | 1999 | 1999 |
| RHD*01W.2.1 | weak D type 2.1 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(F101I,G385A) | 2009 | |
| RHD*01W.2.2 | weak D type 2.2 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(V306I,Y311C,G385A) | 2014 | 2014 |
| RHD*01W.20 | weak D type 20 | cDE | weak D type | Eurasian D cluster | RHD(F417S) | 2000 | 2006 |
| RHD*01W.22 | weak D type 22 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(W408C) | 2000 | |
| RHD*01W.23 | weak D type 23 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G212C) | 2001 | 2001 |
| RHD*01W.24 | weak D type 24 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L338P) | 2003 | 2003 |
| RHD*01W.25 | weak D type 25 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R114Q) | 2005 | |
| RHD*01W.26 | weak D type 26 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V9D) | 2004 | 2005 |
| RHD*01W.27 | weak D type 27 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(P221S) | 2002 | |
| RHD*01W.28 | weak D type 28 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(1152A>C) | 2002 | |
| RHD*01W.29 | weak D type 29 | cDe | weak D type weakened D expression | weak D type 4 cluster | RHD(I60L,S68N,K198N,F223V,I342T) | 2003 | 2003 |
| RHD*01W.3 | weak D type 3 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S3C) | 1999 | 1999 |
| RHD*01W.3.1 | weak D type 3.1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S3C,I60L) | 2014 | 2014 |
| RHD*01W.30 | weak D type 30 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E340M) | 2003 | |
| RHD*01W.31 | weak D type 31 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(P6L) | 2004 | 2005 |
| RHD*01W.32 | weak D type 32 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(I374N) | 2005 | 2005 |
| RHD*01W.33 | weak D type 33 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V174M) | 2003 | 2003 |
| RHD*01W.34 | weak D type 34 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V270E) | 2003 | 2003 |
| RHD*01W.35 | weak D type 35 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G87D) | 2003 | |
| RHD*01W.36 | weak D type 36 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V281G) | 2004 | |
| RHD*01W.37 | weak D type 37 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(K133N) | 2003 | 2004 |
| RHD*01W.38 | weak D type 38 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G278D) | 2003 | 2004 |
| RHD*01W.39 | weak D type 39 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G339R) | 2003 | |
| RHD*01W.40 | weak D type 40 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(T201R) | 2003 | |
| RHD*01W.41 | weak D type 41 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E398V) | 2004 | |
| RHD*01W.42 | weak D type 42 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(K409M) | 2005 | 2005 |
| RHD*01W.43 | weak D type 43 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A202V) | 2006 | 2006 |
| RHD*01W.44 | weak D type 44 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Y243C) | 2004 | |
| RHD*01W.45 | weak D type 45 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(A399T) | 2004 | |
| RHD*01W.46 | weak D type 46 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(F407L) | 2004 | |
| RHD*01W.47 | weak D type 47 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R114G) | 2005 | |
| RHD*01W.48 | weak D type 48 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G61V) | 2005 | |
| RHD*01W.49 | weak D type 49 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S257F) | 2006 | 2007 |
| RHD*01W.5 | weak D type 5 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A149D) | 1999 | 1999 |
| RHD*01W.50 | weak D type 50 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Y243N) | 2006 | |
| RHD*01W.51 | weak D type 51 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD-RHCE(4:594-4:602)-RHD | 2005 | |
| RHD*01W.52 | weak D type 52 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(F31S) | 2005 | |
| RHD*01W.53 | weak D type 53 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V247G) | 2005 | |
| RHD*01W.54 | weak D type 54 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(S122L) | ||
| RHD*01W.55 | weak D type 55 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(L299V) | 2007 | |
| RHD*01W.56 | weak D type 56 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A22E) | 2007 | 2007 |
| RHD*01W.58 | weak D type 58 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G336R) | 2007 | 2007 |
| RHD*01W.59 | weak D type 59 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L383P) | 2007 | 2007 |
| RHD*01W.6 | weak D type 6 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R10Q) | 1999 | 1999 |
| RHD*01W.60 | weak D type 60 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(407delFW) | 2007 | 2007 |
| RHD*01W.61 | weak D type 61 | CDe | weak D type weakened D expression DEL | Eurasian D cluster | RHD(R10W) | 2006 | 2006 |
| RHD*01W.62 | weak D type 62 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(P221T) | 2006 | |
| RHD*01W.63 | weak D type 63 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(I253N) | 2007 | |
| RHD*01W.64 | weak D type 64 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A294V) | 2007 | |
| RHD*01W.65 | weak D type 65 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(A23D) | 2008 | |
| RHD*01W.66 | weak D type 66 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V306I) | 2007 | |
| RHD*01W.67 | weak D type 67 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(T241I) | 2008 | |
| RHD*01W.68 | weak D type 68 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(165C>T,1213C>G) | 2006 | |
| RHD*01W.69 | weak D type 69 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R318Q) | 2008 | |
| RHD*01W.7 | weak D type 7 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G339E) | 1999 | 1999 |
| RHD*01W.70 | weak D type 70 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L338V) | 2008 | |
| RHD*01W.71 | weak D type 71 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R10P) | 2009 | |
| RHD*01W.72 | weak D type 72 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(D404E) | 2007 | |
| RHD*01W.8 | weak D type 8 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G307R) | 1999 | 1999 |
| RHD*01W.9 | weak D type 9 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A294P) | 1999 | 1999 |
| RHD*01w.1.2 | weak D type 1.2 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V238M,V270G) | 2014 | 2014 |
| RHD*01w.41.0.1 | weak D type 41.0.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L390L,E398V) | 2016 | |
| RHD*01w.45.1 | weak D type 45.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A273V,A399T) | 2010 | |
| RHD*01w.45.2 | weak D type 45.2 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R70W,A273V,A399T) | 2013 | 2013 |
| RHD*02 | DII | CDe | Partial D D category | Eurasian D cluster | RHD(A354D) | 1997 | 1997 |
| RHD*03.01 | DIII type 5 | cDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T,T201R,F223V) | ||
| RHD*03.03 | DIIIc | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(3)-RHD | 1996 | 1996 |
| RHD*03.04 | DIII type 4 | CDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T) | 2000 | 2000 |
| RHD*03.04.02 | DIII type 4.2 | not reported | Eurasian D cluster | RHD(L62F,S103P,A137V,N152T) | |||
| RHD*03.06 | DIII type 6 | cDe | Partial D D category | DIVa cluster | RHD(A137V,N152T,T201R,F223V,A273A) | 2005 | 2006 |
| RHD*03.07 | DIII type 7 | cDe | Partial D D category | DIVa cluster | RHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V) | 2005 | 2006 |
| RHD*03.08 | DIII type 8 | not reported | Partial D D category | DIVa cluster | RHD(A137V,N152T) | 2010 | |
| RHD*03.09 | DIII type 9 | not reported | Partial D | DIVa cluster | RHD(L62F,A137V,N152T,F223V) | ||
| RHD*03N.01 | Ccdes-1 | Ccde | D negative | DIVa cluster | RHD(L62F,A137V,N152T)-RHCE(4-7)-RHD(G336C) | 2004 | 2004 |
| RHD*04.01 | DIV type 1.0 | cDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T,D350H) | 2012 | |
| RHD*04.01.02 | DIVa-like | not reported | Eurasian D cluster | RHD(L62F,A137V,N152T,F223V,D350H) | |||
| RHD*04.03 | DIV type 3 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(6-9)-RHD | 1999 | 1999 |
| RHD*04.04 | DIV type 4 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(7:1048-7:1061)-RHD | 1998 | |
| RHD*04.05 | DIV type 5 | cDE | Partial D D category | Eurasian D cluster | RHD-RHCE(7-9)-RHD | 2000 | 2000 |
| RHD*04.06 | DIVb type 2 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(7:1048-9)-RHD | 1995 | 1995 |
| RHD*05.01 | DV type 1 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:697)-RHD | 1995 | 1995 |
| RHD*05.02 | DV type 2 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5)-RHD | 1995 | 1995 |
| RHD*05.03 | DBS-0 | CDe | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:712)-RHD | 1996 | 1996 |
| RHD*05.04 | DV type 4 | CDe | Partial D D category | Eurasian D cluster | RHD(E233Q) | 1998 | 1999 |
| RHD*05.05 | DHK | CDe | Partial D | Eurasian D cluster | RHD(E233K) | 1998 | 1999 |
| RHD*05.06 | DV type 6 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:712)-RHD | 1998 | 1999 |
| RHD*05.07 | DV type 7 | CDe | D category Partial D | Eurasian D cluster | RHD-RHCE(5:667-5:787)-RHD | 2001 | 2001 |
| RHD*05.08 | DV type 8 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:744)-RHD | 1998 | 1999 |
| RHD*05.09 | DV type 9 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:697-5:712)-RHD | 1999 | 2000 |
| RHD*05.10 | DV type 10 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(5-6)-RHD | ||
| RHD*06.01 | DVI type 1 | cDE | D category Partial D | Eurasian D cluster | RHD-RHcE(4-5)-RHD | 1997 | 1997 |
| RHD*06.02 | DVI type 2 | CDe | Partial D D category BARC positive | Eurasian D cluster | RHD-RHCE(4-6)-RHD | 1994 | 1994 |
| RHD*06.03 | DVI type 3 | CDe | Partial D D category BARC positive | Eurasian D cluster | RHD-RHCE(3-6)-RHD | 1998 | 1998 |
| RHD*06.03.02 | DVI type 3.2 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(3-6)-RHD(A399T) | ||
| RHD*06.04 | DVI type 4 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(3-5)-RHD | 2000 | 2006 |
| RHD*07.01 | DVII | CDe | Partial D D category | Eurasian D cluster | RHD(L110P) | 1995 | 1995 |
| RHD*07.02 | DVII type 2 | CDe | Partial D | Eurasian D cluster | RHD(S103P,L110P) | 2001 | 2001 |
| RHD*08.01 | DFV | multiple | Partial D | weak D type 4 cluster | RHD(F223V) | 2002 | 2002 |
| RHD*08N.01 | RHD psi | cDe | D negative | weak D type 4 cluster | RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G) | 2000 | 2000 |
| RHD*09. 05 | weak D type 4.3 | cDe | weak D type DEL weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V,P291R)[819G>A] | 2004 | |
| RHD*09.01 | DAR(T203A) | cDe | Partial D | weak D type 4 cluster | RHD(T201R,T203A,F223V,I342T) | 2012 | 2012 |
| RHD*09.01.00 | DAR1 (weak D type 4.2.0) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,I342T) | 1998 | 1999 |
| RHD*09.01.01 | weak D type 4.2.1 (DAR1.1) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,,I342T)[957G>A] | 2000 | 2000 |
| RHD*09.01.02 | weak D type 4.2.2 (DAR1.2) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,I342T)[744C>T,957G>A] | 2000 | 2000 |
| RHD*09.01.03 | weak D type 4.2.3 (DAR1.3) | cDe | weak D type Partial D weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,I342T)[744C] | 2008 | |
| RHD*09.02 | DAR-E | cDe | Partial D weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,E233Q,I342T)[957G>A] | 2006 | 2006 |
| RHD*09.02.01 | DAR2.1 | not reported | Partial D | weak D type 4 cluster | RHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A] | ||
| RHD*09.03 | weak D type 4.0.1 | cDe | weak D type weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V) | ||
| RHD*09.03.01 | weak D type 4.0 | cDe | weak D type weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V)[819G>A] | 1999 | 1999 |
| RHD*09.04 | weak D type 4.1 | cDe | weak D type weakened D expression | weak D type 4 cluster | RHD(W16C,T201R,F223V) | 2000 | 2000 |
| RHD*09.06 | DAR(CE2:V50V-S68N) | cDe | Partial D | weak D type 4 cluster | RHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C) | 2013 | |
| RHD*10.00 | DAU-0 | cDe | D positive (apparently normal) Partial D | DAU cluster | RHD(T379M) | 2002 | 2002 |
| RHD*10.00.01 | DAU-0.1 | cDe | DAU cluster | RHD(579G>A,1136C>T) | 2003 | 2003 | |
| RHD*10.00.02 | DAU-0.2 | not reported | Eurasian D cluster | RHD(150T>C,1136C>T) | |||
| RHD*10.01 | DAU-1 | cDe | Partial D | DAU cluster | RHD(S230I,T379M) | 2002 | 2002 |
| RHD*10.02 | DAU-2 | cDe | Partial D weakened D expression | DAU cluster | RHD(R70Q,S333N,T379M) | 2002 | 2002 |
| RHD*10.03 | DAU-3 | cDe | Partial D | DAU cluster | RHD(V279M,T379M) | 2002 | 2002 |
| RHD*10.04 | DAU-4 | cDe | Partial D weakened D expression | DAU cluster | RHD(E233K,T379M) | 2002 | 2002 |
| RHD*10.05 | DAU-5 | cDe | Partial D | DAU cluster | RHD(F223V,E233Q,T379M) | 2005 | 2005 |
| RHD*10.05.01 | DAU-5.1 | cDe | weakened D expression | DAU cluster | RHD(F223V,E233Q,T379M)[1122C>T] | 2014 | 2016 |
| RHD*10.06 | DAU-6 | cDe | Partial D | DAU cluster | RHD(S333N,T379M) | 2005 | 2005 |
| RHD*10.07 | DAU-7 | cDe | Partial D | DAU cluster | RHD(V279M,S333N,T379M) | 2009 | 2009 |
| RHD*10.08 | DAU-8 | not reported | D positive (no further data) | DAU cluster | RHD(R114W,T379M)[579G>A] | 2012 | 2012 |
| RHD*10.09 | DAU-9 | not reported | D positive (no further data) | DAU cluster | RHD(F179L,T379M) | 2012 | 2012 |
| RHD*10.10 | DAU-10 | not reported | D positive (no further data) | DAU cluster | RHD(V247L,T379M)[579G>A] | 2012 | 2012 |
| RHD*10.11 | DAU-11 | cDe | weakened D expression | DAU cluster | RHD(A85V,V279M,T379M) | 2012 | 2016 |
| RHD*10.12 | DAU-12 | cDe | DAU cluster | RHD(L181P,T379M) | 2012 | ||
| RHD*10.13 | DAU-13 | cDe | DAU cluster | RHD(W16C,T379M) | 2013 | ||
| RHD*10.14 | DAU-14 | cDe | D positive (no further data) | DAU cluster | RHD(S68N,T379M)[201G>A] | 2014 | 2014 |
| RHD*10.15 | RHD(M1V,T379M) | not reported | DAU cluster | RHD(M1V,T379M) | 2008 | ||
| RHD*1007A | RHD(G336D) | not reported | D negative | Eurasian D cluster | RHD(G336D) | 2011 | |
| RHD*1074-2C | RHD(IVS7-2A>C) | not reported | Eurasian D cluster | RHD(IVS7-2A>C) | 2011 | ||
| RHD*11 | RHD(M295I) | CDe | DEL Partial D | Eurasian D cluster | RHD(M295I) | 2001 | 2001 |
| RHD*11 | weak D type 11 | cDe | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(M295I) | 1999 | 1999 |
| RHD*1179A | RHD(W393X) | not reported | Eurasian D cluster | RHD(W393X) | 2014 | 2014 | |
| RHD*12.01 | DOL-1 | cDe | Partial D | weak D type 4 cluster | RHD(M170T,F223V) | 1999 | 2009 |
| RHD*12.02 | DOL-2 | not reported | Partial D | weak D type 4 cluster | RHD(M170T,F223V,L378V) | 2005 | 2009 |
| RHD*12.03 | DOL-3 | not reported | Partial D | weak D type 4 cluster | RHD(A137V,M170T,F223V) | 2005 | |
| RHD*12.04 | DOL-4 | not reported | Partial D | DIVa cluster | |||
| RHD*1228-1A | RHD(IVS9-1G>A) | CDe | Eurasian D cluster | RHD(IVS9-1G>A) | 2014 | 2014 | |
| RHD*13.01 | DBS-1 | cDE | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:800)-RHD | 2001 | 2001 |
| RHD*13.02 | DBS-2 | cDE | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:697)-RHD | 2009 | 2012 |
| RHD*14.01 | DBT-1 | CDe | Partial D | Eurasian D cluster | RHD-RHCe(5-7)-RHD | 1996 | 1996 |
| RHD*14.02 | DBT-2 | CDe | Partial D | Eurasian D cluster | RHD-RHCe(5-9)-RHD | 1999 | 1999 |
| RHD*15 | weak D type 15 | cDE | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(G282D) | 1999 | 1999 |
| RHD*16.01 | DCS-1 | cDE | Partial D | Eurasian D cluster | RHD(F223V,A226P) | 1999 | 2008 |
| RHD*16.02 | DCS-2 | cDE | Partial D | Eurasian D cluster | RHD(A226P) | 2008 | 2008 |
| RHD*16.03 | DBS-2 | cDE | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:697)-RHD | 2009 | 2012 |
| RHD*17.01 | DFR-1 | multiple | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:514)-RHD | 1995 | 1995 |
| RHD*17.02 | DFR-2 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4)-RHD | 1997 | 1997 |
| RHD*17.03 | DFR-3 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:514)-RHD(G180A) | 2007 | 2007 |
| RHD*17.04 | DFR-4 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:509)-RHD | 2009 | 2012 |
| RHD*17.05 | DFR-5 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(3-4)-RHD | 2007 | |
| RHD*18 | DFW | CDe | Partial D | Eurasian D cluster | RHD(H166P) | 1998 | 2009 |
| RHD*19 | DHMi | cDE | Partial D | Eurasian D cluster | RHD(T283I) | 1996 | |
| RHD*20 | DHO | CDe | Partial D weakened D expression | Eurasian D cluster | RHD(K235T) | 2001 | 2001 |
| RHD*21 | weak D type 21 | CDe | weak D type Partial D weakened D expression | Eurasian D cluster | RHD(P313L) | 2001 | 2001 |
| RHD*22 | DHR | not reported | Partial D | Eurasian D cluster | RHD(R229K) | 1997 | 1997 |
| RHD*23 | DMH | cDe | Partial D | Eurasian D cluster | RHD(L54P) | 1999 | |
| RHD*24 | DNAK | cDE | Partial D | Eurasian D cluster | RHD(G357D) | 2005 | |
| RHD*25 | DNB | CDe | Partial D | Eurasian D cluster | RHD(G355S) | 2002 | 2002 |
| RHD*26 | DNU | cDE | Partial D | Eurasian D cluster | RHD(G353R) | 1997 | 1997 |
| RHD*27 | DDE | not reported | Partial D | Eurasian D cluster | RHD(D40E) | 2007 | |
| RHD*28 | DFL | CDe | Partial D | Eurasian D cluster | RHD(Y165C) | 2005 | 2007 |
| RHD*29 | DYU | cDe | Partial D | Eurasian D cluster | RHD(R234W) | 2003 | 2005 |
| RHD*30 | DTO | not reported | weakened D expression Partial D | weak D type 4 cluster | RHD(F223V,S225F) | 2005 | 2005 |
| RHD*31 | DVL-1 | not reported | Partial D | Eurasian D cluster | RHD(229delR) | 2004 | 2006 |
| RHD*32 | DVL-2 | not reported | Partial D weakened D expression | Eurasian D cluster | RHD(235delK) | 2006 | 2006 |
| RHD*33 | DWI | CDe | Partial D | Eurasian D cluster | RHD(M358T) | 2004 | 2004 |
| RHD*34 | DIM | cDE | Partial D weakened D expression | Eurasian D cluster | RHD(C285Y) | 2000 | 2000 |
| RHD*35 | DMA | cDe | Eurasian D cluster | RHD(L207F) | 2003 | 2003 | |
| RHD*36 | DLO | not reported | weakened D expression Partial D | Eurasian D cluster | RHD(S284L) | 2003 | 2004 |
| RHD*37 | DUC-2 | not reported | D positive (apparently normal) | Eurasian D cluster | RHD(V245L) | 2005 | 2005 |
| RHD*39 | RHD(S103P) | cDE | Partial D | Eurasian D cluster | RHD(S103P) | 1996 | 1996 |
| RHD*40 | D-SPM | cDe | Partial D | DIVa cluster | RHD(L62F,A137V,N152T,M170T,F223V) | 2012 | |
| RHD*41 | DBU | cDE | DEL Partial D | Eurasian D cluster | RHD-cE(5-7;226P)-D | 2008 | 2009 |
| RHD*42 | DCC | CDe | Partial D | Eurasian D cluster | RHD(A226D) | 2007 | 2012 |
| RHD*424_426delATG | RHD(142delM) | not reported | D negative | Eurasian D cluster | RHD(142delM) | ||
| RHD*43 | DDN | not reported | Partial D | Eurasian D cluster | RHD(D164N) | 2008 | |
| RHD*44 | DHQ | not reported | Partial D | Eurasian D cluster | RHD(H171Q) | 2004 | |
| RHD*443G | RHD(T148R) | not reported | D negative | Eurasian D cluster | RHD(T148R) | 2012 | 2012 |
| RHD*45 | DKK | cDE | Partial D | Eurasian D cluster | RHD-RHCE(2-3)-RHD | 2000 | 2001 |
| RHD*46 | DLX | cDE | Partial D | Eurasian D cluster | RHD(F223V)-RHCE(5:712-6)-RHD | 2012 | 2012 |
| RHD*47 | DMI | CDe | Partial D | Eurasian D cluster | RHD(M170I) | 2008 | 2009 |
| RHD*47.01 | DMI-1.1 | CDe | Partial D | Eurasian D cluster | RHD(M170I) | 2010 | |
| RHD*48 | DNS | not reported | Partial D | Eurasian D cluster | RHD(N162S) | 2006 | |
| RHD*49 | DWN | cDe | Partial D | Eurasian D cluster | RHD-RHCE(7:1053-7:1061)-RHD | 2013 | 2013 |
| RHD*50 | RHD(A354T) | CDe | Partial D | Eurasian D cluster | RHD(A354T) | 2014 | 2014 |
| RHD*51 | RHD(del44L) | not reported | Partial D | Eurasian D cluster | RHD(130delCTC) | 2013 | 2014 |
| RHD*52 | weak D type 141 | cDe | Partial D weakened D expression weak D type | Eurasian D cluster | RHD(F223S) | 2015 | 2016 |
| RHD*53 | RHD(IVS2-2delA) | not reported | DEL Partial D | Eurasian D cluster | RHD(IVS2-2delA) | 2013 | |
| RHD*54 | RHD(IVS4-2A>C) | cDE | Partial D | Eurasian D cluster | RHD(IVS4-2A>C) | 2014 | 2014 |
| RHD*55 | RHD(L81P) | not reported | weakened D expression Partial D | Eurasian D cluster | RHD(L81P) | 2009 | |
| RHD*56 | DBA | not reported | weakened D expression | Eurasian D cluster | RHD(L227P) | 2003 | 2004 |
| RHD*57 | weak D type 57 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(L214F) | 2007 | 2007 |
| RHD*58 | RHD-RHCE(7)-RHD | cDE | Partial D D category | Eurasian D cluster | RHD-RHCE(7)-RHD | 2012 | |
| RHD*581_582insG | RHD(581insG) | not reported | Eurasian D cluster | RHD(581insG) | |||
| RHD*59 | RHD(F175L) | not reported | Partial D | Eurasian D cluster | RHD(F175L) | 2012 | 2012 |
| RHD*60 | RHD(60L,S230I) | not reported | Eurasian D cluster | RHD(I60L,S230I) | |||
| RHD*61 | RHD(D164E) | not reported | Partial D | Eurasian D cluster | RHD(D164E) | ||
| RHD*62 | RHD(N152T,V270G) | not reported | Eurasian D cluster | RHD(N152T,V270G) | 2014 | ||
| RHD*660delG | RHD(660delG) | CDe | D negative | Eurasian D cluster | RHD(660delG) | 2008 | 2009 |
| RHD*697delG | RHD(697delG) | not reported | D negative | Eurasian D cluster | RHD(697delG) | ||
| RHD*702delG | RHD(702delG) | not reported | D negative | Eurasian D cluster | RHD(702delG) | 2017 | |
| RHD*896C | RHD(L299P) | not reported | Eurasian D cluster | RHD(L299P) | 2011 | ||
| RHD*D-SPM | D-SPM | cDe | Partial D | DIVa cluster | RHD(L62F,A137V,N152T,M170T,F223V) | 2012 | |
| RHD*DAR | DAR(T203A) | cDe | Partial D | weak D type 4 cluster | RHD(T201R,T203A,F223V,I342T) | 2012 | 2012 |
| RHD*DAR(SE2:v50V-S68N) | DAR(CE2:V50V-S68N) | cDe | Partial D | weak D type 4 cluster | RHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C) | 2013 | |
| RHD*DAR1.00 | DAR1 (weak D type 4.2.0) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,I342T) | 1998 | 1999 |
| RHD*DAR1.01 | weak D type 4.2.1 (DAR1.1) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,,I342T)[957G>A] | 2000 | 2000 |
| RHD*DAR1.03 | weak D type 4.2.3 (DAR1.3) | cDe | weak D type Partial D weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,I342T)[744C] | 2008 | |
| RHD*DAR2 | DAR-E | cDe | Partial D weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,E233Q,I342T)[957G>A] | 2006 | 2006 |
| RHD*DAR2.01 | DAR2.1 | not reported | Partial D | weak D type 4 cluster | RHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A] | ||
| RHD*DAR3 | weak D type 4.0 | cDe | weak D type weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V)[819G>A] | 1999 | 1999 |
| RHD*DAR3 | weak D type 4.0.1 | cDe | weak D type weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V) | ||
| RHD*DAR4 | weak D type 4.1 | cDe | weak D type weakened D expression | weak D type 4 cluster | RHD(W16C,T201R,F223V) | 2000 | 2000 |
| RHD*DAR6 | DAR(CE2:V50V-S68N) | cDe | Partial D | weak D type 4 cluster | RHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C) | 2013 | |
| RHD*DAU0 | DAU-0 | cDe | D positive (apparently normal) Partial D | DAU cluster | RHD(T379M) | 2002 | 2002 |
| RHD*DAU0.01 | DAU-0.1 | cDe | DAU cluster | RHD(579G>A,1136C>T) | 2003 | 2003 | |
| RHD*DAU0.02 | DAU-0.2 | not reported | Eurasian D cluster | RHD(150T>C,1136C>T) | |||
| RHD*DAU1 | DAU-1 | cDe | Partial D | DAU cluster | RHD(S230I,T379M) | 2002 | 2002 |
| RHD*DAU10 | DAU-10 | not reported | D positive (no further data) | DAU cluster | RHD(V247L,T379M)[579G>A] | 2012 | 2012 |
| RHD*DAU11 | DAU-11 | cDe | weakened D expression | DAU cluster | RHD(A85V,V279M,T379M) | 2012 | 2016 |
| RHD*DAU12 | DAU-12 | cDe | DAU cluster | RHD(L181P,T379M) | 2012 | ||
| RHD*DAU13 | DAU-13 | cDe | DAU cluster | RHD(W16C,T379M) | 2013 | ||
| RHD*DAU14 | DAU-14 | cDe | D positive (no further data) | DAU cluster | RHD(S68N,T379M)[201G>A] | 2014 | 2014 |
| RHD*DAU15 | RHD(M1V,T379M) | not reported | DAU cluster | RHD(M1V,T379M) | 2008 | ||
| RHD*DAU2 | DAU-2 | cDe | Partial D weakened D expression | DAU cluster | RHD(R70Q,S333N,T379M) | 2002 | 2002 |
| RHD*DAU3 | DAU-3 | cDe | Partial D | DAU cluster | RHD(V279M,T379M) | 2002 | 2002 |
| RHD*DAU4 | DAU-4 | cDe | Partial D weakened D expression | DAU cluster | RHD(E233K,T379M) | 2002 | 2002 |
| RHD*DAU5 | DAU-5 | cDe | Partial D | DAU cluster | RHD(F223V,E233Q,T379M) | 2005 | 2005 |
| RHD*DAU5.01 | DAU-5.1 | cDe | weakened D expression | DAU cluster | RHD(F223V,E233Q,T379M)[1122C>T] | 2014 | 2016 |
| RHD*DAU6 | DAU-6 | cDe | Partial D | DAU cluster | RHD(S333N,T379M) | 2005 | 2005 |
| RHD*DAU7 | DAU-7 | cDe | Partial D | DAU cluster | RHD(V279M,S333N,T379M) | 2009 | 2009 |
| RHD*DAU8 | DAU-8 | not reported | D positive (no further data) | DAU cluster | RHD(R114W,T379M)[579G>A] | 2012 | 2012 |
| RHD*DAU9 | DAU-9 | not reported | D positive (no further data) | DAU cluster | RHD(F179L,T379M) | 2012 | 2012 |
| RHD*DBA | DBA | not reported | weakened D expression | Eurasian D cluster | RHD(L227P) | 2003 | 2004 |
| RHD*DBS1 | DBS-1 | cDE | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:800)-RHD | 2001 | 2001 |
| RHD*DBS2 | DBS-2 | cDE | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:697)-RHD | 2009 | 2012 |
| RHD*DBT1 | DBT-1 | CDe | Partial D | Eurasian D cluster | RHD-RHCe(5-7)-RHD | 1996 | 1996 |
| RHD*DBT2 | DBT-2 | CDe | Partial D | Eurasian D cluster | RHD-RHCe(5-9)-RHD | 1999 | 1999 |
| RHD*DBU | DBU | cDE | DEL Partial D | Eurasian D cluster | RHD-cE(5-7;226P)-D | 2008 | 2009 |
| RHD*DCC | DCC | CDe | Partial D | Eurasian D cluster | RHD(A226D) | 2007 | 2012 |
| RHD*DCS1 | DCS-1 | cDE | Partial D | Eurasian D cluster | RHD(F223V,A226P) | 1999 | 2008 |
| RHD*DCS2 | DCS-2 | cDE | Partial D | Eurasian D cluster | RHD(A226P) | 2008 | 2008 |
| RHD*DDE | DDE | not reported | Partial D | Eurasian D cluster | RHD(D40E) | 2007 | |
| RHD*DDN | DDN | not reported | Partial D | Eurasian D cluster | RHD(D164N) | 2008 | |
| RHD*DEL1 | RHD(1227G>A) | CDe | DEL | Eurasian D cluster | RHD(1227G>A) | 2001 | 2001 |
| RHD*DEL10 | RHD(W408R) | CDe | DEL | Eurasian D cluster | RHD(W408R) | 2005 | 2005 |
| RHD*DEL11 | RHD(X418L) | CDe | DEL | Eurasian D cluster | RHD(X418L) | 2005 | 2005 |
| RHD*DEL12 | RHD(L153P) | cDE | DEL | Eurasian D cluster | RHD(L153P) | 2004 | 2009 |
| RHD*DEL13 | RHD(786del A) | CDe | D negative | Eurasian D cluster | RHD(785del A) | 2004 | 2009 |
| RHD*DEL14 | RHD(IVS4+5G>T) | CDe | weakened D expression | Eurasian D cluster | RHD(IVS4+5G>T) | 2010 | 2013 |
| RHD*DEL15 | RHD(G308X) | CDe | D negative | Eurasian D cluster | RHD(G308X) | 2010 | |
| RHD*DEL16 | RHD(G212R) | cDe | DEL | Eurasian D cluster | RHD(G212R) | 2008 | 2009 |
| RHD*DEL17 | RHD(Y401X) | cDE | D negative | Eurasian D cluster | RHD(Y401X) | 2004 | 2005 |
| RHD*DEL18 | RHD(93insT) | CDe | DEL D negative | Eurasian D cluster | RHD(93dupT) | 2008 | 2008 |
| RHD*DEL19 | RHD(IVS4-2A>G) | not reported | weakened D expression | Eurasian D cluster | RHD(IVS4-2A>G) | 2010 | 2011 |
| RHD*DEL2 | RHD(M1I) | not reported | DEL | Eurasian D cluster | RHD(M1I) | 2006 | 2006 |
| RHD*DEL20 | RHD(IVS8-8T>A) | not reported | weakened D expression | Eurasian D cluster | RHD(IVS8-8T>A) | 2007 | 2007 |
| RHD*DEL21 | RHD(IVS1+5G>C) | not reported | DEL | Eurasian D cluster | RHD(IVS1+5G>C) | 2013 | |
| RHD*DEL24 | DEL RHD(A280T) | not reported | DEL | Eurasian D cluster | RHD(A280T) | 2014 | 2014 |
| RHD*DEL25 | DEL RHD(X418K) | CDe | DEL | Eurasian D cluster | RHD(X418K) | 2015 | 2015 |
| RHD*DEL26 | RHD(1248insG) | CDe | DEL | Eurasian D cluster | RHD(1248insG) | 2014 | 2014 |
| RHD*DEL28 | RHD(993delC) | not reported | Eurasian D cluster | RHD(993delC) | 2014 | ||
| RHD*DEL29 | RHD(D404H) | cDE | DEL | Eurasian D cluster | RHD(D404H) | 2012 | |
| RHD*DEL3 | RHD(L18P) | not reported | DEL | Eurasian D cluster | RHD(L18P) | 2006 | 2006 |
| RHD*DEL30 | RHD(del Ex8) | not reported | DEL | Eurasian D cluster | RHD(del Ex8) | 2007 | 2007 |
| RHD*DEL31 | RHD(IVS1+1G>T) | cDE | DEL | Eurasian D cluster | RHD(1481G>T) | 2014 | 2014 |
| RHD*DEL32 | RHD(IVS1-29G>C) | CDe | DEL | Eurasian D cluster | RHD(IVS1-29G>C) | 2012 | |
| RHD*DEL33 | RHD(IVS2-2A>G) | not reported | DEL | Eurasian D cluster | RHD(IVS2-2A>G) | 2011 | 2011 |
| RHD*DEL36 | RHD(IVS7+152C>A,1227G>A) | CDe | DEL | Eurasian D cluster | RHD(IVS7+152C>A,1227G>A) | 2002 | 2002 |
| RHD*DEL37 | RHD(IVS8-31C>T) | not reported | DEL | Eurasian D cluster | RHD(IVS8-31C>T) | 2012 | |
| RHD*DEL38 | RHD(L337R) | CDe | D negative DEL | Eurasian D cluster | RHD(L337R) | 2014 | 2014 |
| RHD*DEL39 | RHD(L38X) | not reported | DEL | Eurasian D cluster | RHD(L38X) | 2010 | |
| RHD*DEL4 | RHD(147del A) | CDe | DEL | Eurasian D cluster | RHD(147del A) | 2004 | 2009 |
| RHD*DEL40 | RHD(L93R) | CDe | DEL | Eurasian D cluster | RHD(L93R) | 2014 | 2014 |
| RHD*DEL41 | RHD(P291R) | CDe | DEL | Eurasian D cluster | RHD(P291R) | 2012 | |
| RHD*DEL42 | RHD(S112T) | not reported | DEL | Eurasian D cluster | RHD(S112T) | 2012 | |
| RHD*DEL43 | RHD(W16R) | cDE | DEL | Eurasian D cluster | RHD(W16R) | 2012 | |
| RHD*DEL44 | RHD-RHCE(4-9)-RHD | CDe | DEL | Eurasian D cluster | RHD-RHCE(4-9)-RHD | 2009 | 2009 |
| RHD*DEL45 | RHD(T241P) | not reported | Eurasian D cluster | RHD(T241P) | |||
| RHD*DEL5 | RHD(IVS1+1G>A) | not reported | DEL | Eurasian D cluster | RHD(IVS1+1G>A) | 2001 | |
| RHD*DEL6 | RHD(L84P) | not reported | DEL | Eurasian D cluster | RHD(L84P) | 2006 | 2006 |
| RHD*DEL7 | RHD(A137E) | CDe | DEL | Eurasian D cluster | RHD(A137E) | 2006 | 2009 |
| RHD*DEL8 | RHD(IVS3+1G>A) | CDe | DEL D negative | Eurasian D cluster | RHD(IVS3+1G>A) | 2001 | 2001 |
| RHD*DEL9 | RHD(IVS3+2T>A) | cDE | D negative | Eurasian D cluster | RHD(IVS3+2T>A) | 2008 | 2009 |
| RHD*DFL | DFL | CDe | Partial D | Eurasian D cluster | RHD(Y165C) | 2005 | 2007 |
| RHD*DFR1 | DFR-1 | multiple | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:514)-RHD | 1995 | 1995 |
| RHD*DFR2 | DFR-2 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4)-RHD | 1997 | 1997 |
| RHD*DFR3 | DFR-3 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:514)-RHD(G180A) | 2007 | 2007 |
| RHD*DFR4 | DFR-4 | CDe | Partial D | Eurasian D cluster | RHD-RHCE(4:505-4:509)-RHD | 2009 | 2012 |
| RHD*DFR5 | DFR-5 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(3-4)-RHD | 2007 | |
| RHD*DFV | DFV | multiple | Partial D | weak D type 4 cluster | RHD(F223V) | 2002 | 2002 |
| RHD*DFW | DFW | CDe | Partial D | Eurasian D cluster | RHD(H166P) | 1998 | 2009 |
| RHD*DHMi | DHMi | cDE | Partial D | Eurasian D cluster | RHD(T283I) | 1996 | |
| RHD*DHO | DHO | CDe | Partial D weakened D expression | Eurasian D cluster | RHD(K235T) | 2001 | 2001 |
| RHD*DHQ | DHQ | not reported | Partial D | Eurasian D cluster | RHD(H171Q) | 2004 | |
| RHD*DHR | DHR | not reported | Partial D | Eurasian D cluster | RHD(R229K) | 1997 | 1997 |
| RHD*DII | DII | CDe | Partial D D category | Eurasian D cluster | RHD(A354D) | 1997 | 1997 |
| RHD*DII.04.02 | DIII type 4.2 | not reported | Eurasian D cluster | RHD(L62F,S103P,A137V,N152T) | |||
| RHD*DIII.07 | DIII type 7 | cDe | Partial D D category | DIVa cluster | RHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V) | 2005 | 2006 |
| RHD*DIII.08 | DIII type 8 | not reported | Partial D D category | DIVa cluster | RHD(A137V,N152T) | 2010 | |
| RHD*DIII.09 | DIII type 9 | not reported | Partial D | DIVa cluster | RHD(L62F,A137V,N152T,F223V) | ||
| RHD*DIII.4 | DIII type 4 | CDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T) | 2000 | 2000 |
| RHD*DIII.6 | DIII type 6 | cDe | Partial D D category | DIVa cluster | RHD(A137V,N152T,T201R,F223V,A273A) | 2005 | 2006 |
| RHD*DIIIa | DIII type 5 | cDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T,T201R,F223V) | ||
| RHD*DIIIc | DIIIc | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(3)-RHD | 1996 | 1996 |
| RHD*DIM | DIM | cDE | Partial D weakened D expression | Eurasian D cluster | RHD(C285Y) | 2000 | 2000 |
| RHD*DIV.4 | DIV type 4 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(7:1048-7:1061)-RHD | 1998 | |
| RHD*DIV.5 | DIV type 5 | cDE | Partial D D category | Eurasian D cluster | RHD-RHCE(7-9)-RHD | 2000 | 2000 |
| RHD*DIVa. | DIV type 1.0 | cDe | Partial D D category | DIVa cluster | RHD(L62F,A137V,N152T,D350H) | 2012 | |
| RHD*DKK | DKK | cDE | Partial D | Eurasian D cluster | RHD-RHCE(2-3)-RHD | 2000 | 2001 |
| RHD*DLO | DLO | not reported | weakened D expression Partial D | Eurasian D cluster | RHD(S284L) | 2003 | 2004 |
| RHD*DLX | DLX | cDE | Partial D | Eurasian D cluster | RHD(F223V)-RHCE(5:712-6)-RHD | 2012 | 2012 |
| RHD*DMA | DMA | cDe | Eurasian D cluster | RHD(L207F) | 2003 | 2003 | |
| RHD*DMH | DMH | cDe | Partial D | Eurasian D cluster | RHD(L54P) | 1999 | |
| RHD*DMI | DMI | CDe | Partial D | Eurasian D cluster | RHD(M170I) | 2008 | 2009 |
| RHD*DMI-1.1 | DMI-1.1 | CDe | Partial D | Eurasian D cluster | RHD(M170I) | 2010 | |
| RHD*DNAK | DNAK | cDE | Partial D | Eurasian D cluster | RHD(G357D) | 2005 | |
| RHD*DNB | DNB | CDe | Partial D | Eurasian D cluster | RHD(G355S) | 2002 | 2002 |
| RHD*DNS | DNS | not reported | Partial D | Eurasian D cluster | RHD(N162S) | 2006 | |
| RHD*DNU | DNU | cDE | Partial D | Eurasian D cluster | RHD(G353R) | 1997 | 1997 |
| RHD*DOL1 | DOL-1 | cDe | Partial D | weak D type 4 cluster | RHD(M170T,F223V) | 1999 | 2009 |
| RHD*DOL2 | DOL-2 | not reported | Partial D | weak D type 4 cluster | RHD(M170T,F223V,L378V) | 2005 | 2009 |
| RHD*DOL3 | DOL-3 | not reported | Partial D | weak D type 4 cluster | RHD(A137V,M170T,F223V) | 2005 | |
| RHD*DOL4 | DOL-4 | not reported | Partial D | DIVa cluster | |||
| RHD*DTO | DTO | not reported | weakened D expression Partial D | weak D type 4 cluster | RHD(F223V,S225F) | 2005 | 2005 |
| RHD*DUC2 | DUC-2 | not reported | D positive (apparently normal) | Eurasian D cluster | RHD(V245L) | 2005 | 2005 |
| RHD*DV.1 | DV type 1 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:697)-RHD | 1995 | 1995 |
| RHD*DV.10 | DV type 10 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(5-6)-RHD | ||
| RHD*DV.2 | DV type 2 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5)-RHD | 1995 | 1995 |
| RHD*DV.3 | DBS-0 | CDe | Partial D | Eurasian D cluster | RHD-RHcE(5:667-5:712)-RHD | 1996 | 1996 |
| RHD*DV.4 | DV type 4 | CDe | Partial D D category | Eurasian D cluster | RHD(E233Q) | 1998 | 1999 |
| RHD*DV.5 | DHK | CDe | Partial D | Eurasian D cluster | RHD(E233K) | 1998 | 1999 |
| RHD*DV.6 | DV type 6 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:712)-RHD | 1998 | 1999 |
| RHD*DV.7 | DV type 7 | CDe | D category Partial D | Eurasian D cluster | RHD-RHCE(5:667-5:787)-RHD | 2001 | 2001 |
| RHD*DV.8 | DV type 8 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:667-5:744)-RHD | 1998 | 1999 |
| RHD*DV.9 | DV type 9 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(5:697-5:712)-RHD | 1999 | 2000 |
| RHD*DVI.03.02 | DVI type 3.2 | not reported | Partial D | Eurasian D cluster | RHD-RHCE(3-6)-RHD(A399T) | ||
| RHD*DVI.1 | DVI type 1 | cDE | D category Partial D | Eurasian D cluster | RHD-RHcE(4-5)-RHD | 1997 | 1997 |
| RHD*DVI.2 | DVI type 2 | CDe | Partial D D category BARC positive | Eurasian D cluster | RHD-RHCE(4-6)-RHD | 1994 | 1994 |
| RHD*DVI.3 | DVI type 3 | CDe | Partial D D category BARC positive | Eurasian D cluster | RHD-RHCE(3-6)-RHD | 1998 | 1998 |
| RHD*DVI.4 | DVI type 4 | CDe | Partial D D category | Eurasian D cluster | RHD-RHCE(3-5)-RHD | 2000 | 2006 |
| RHD*DVII.1 | DVII | CDe | Partial D D category | Eurasian D cluster | RHD(L110P) | 1995 | 1995 |
| RHD*DVII.2 | DVII type 2 | CDe | Partial D | Eurasian D cluster | RHD(S103P,L110P) | 2001 | 2001 |
| RHD*DVL1 | DVL-1 | not reported | Partial D | Eurasian D cluster | RHD(229delR) | 2004 | 2006 |
| RHD*DVL2 | DVL-2 | not reported | Partial D weakened D expression | Eurasian D cluster | RHD(235delK) | 2006 | 2006 |
| RHD*DWI | DWI | CDe | Partial D | Eurasian D cluster | RHD(M358T) | 2004 | 2004 |
| RHD*DWN | DWN | cDe | Partial D | Eurasian D cluster | RHD-RHCE(7:1053-7:1061)-RHD | 2013 | 2013 |
| RHD*DYU | DYU | cDe | Partial D | Eurasian D cluster | RHD(R234W) | 2003 | 2005 |
| RHD*Pseudogene | RHD psi | cDe | D negative | weak D type 4 cluster | RHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G) | 2000 | 2000 |
| RHD*weak 4.2 | weak D type 4.2.1 (DAR1.1) | cDe | Partial D weak D type weakened D expression | weak D type 4 cluster | RHD(T201R,F223V,,I342T)[957G>A] | 2000 | 2000 |
| RHD*weak 4.3 | weak D type 4.3 | cDe | weak D type DEL weakened D expression Partial D | weak D type 4 cluster | RHD(T201R,F223V,P291R)[819G>A] | 2004 | |
| RHD*weak D type 1 | weak D type 1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V270G) | 1999 | 1999 |
| RHD*weak D type 1.1 | weak D type 1.1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L18V,V270G) | 2004 | 2005 |
| RHD*weak D type 1.2 | weak D type 1.2 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V238M,V270G) | 2014 | 2014 |
| RHD*weak D type 10 | weak D type 10 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W393R) | 1999 | 1999 |
| RHD*weak D type 10.1 | weak D type 10.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L382P,W393R) | 2016 | |
| RHD*weak D type 10.2 | weak D type 10.2 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(W393R,K400T) | 2015 | 2016 |
| RHD*weak D type 100 | weak D type 100 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G263R) | 2010 | |
| RHD*weak D type 101 | weak D type 101 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(E21A) | 2015 | |
| RHD*weak D type 102 | weak D type 102 | multiple | weakened D expression weak D type | Eurasian D cluster | RHD(I25F) | 2016 | |
| RHD*weak D type 103 | weak D type 103 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(F31I) | 2015 | |
| RHD*weak D type 104 | RHD(D53Y) | not reported | weakened D expression | Eurasian D cluster | RHD(D53Y) | 2015 | |
| RHD*weak D type 105 | weak D type 105 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(S67W) | 2015 | 2015 |
| RHD*weak D type 106 | weak D type 106 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W74G) | 2015 | 2015 |
| RHD*weak D type 107 | weak D type 107 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S75C) | 2015 | |
| RHD*weak D type 108 | RHD(G96D) | not reported | weakened D expression | Eurasian D cluster | RHD(G96D) | 2015 | 2015 |
| RHD*weak D type 109 | weak D type 109 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S126P) | 2015 | |
| RHD*weak D type 110 | weak D type 110 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(Q138R) | 2015 | 2015 |
| RHD*weak D type 111 | weak D type 111 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(G212S) | 2015 | |
| RHD*weak D type 112 | weak D type 112 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(G212D) | 2015 | 2015 |
| RHD*weak D type 113 | weak D type 113 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(W292R) | 2015 | |
| RHD*weak D type 114 | weak D type 114 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(P323L) | 2015 | 2015 |
| RHD*weak D type 115 | weak D type 115 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(M328K) | 2015 | 2015 |
| RHD*weak D type 116 | weak D type 116 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116P) | 2015 | 2015 |
| RHD*weak D type 117 | weak D type 117 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116T) | 2015 | |
| RHD*weak D type 118 | weak D type 118 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A116V) | 2010 | |
| RHD*weak D type 119 | weak D type 119 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A273V) | 2010 | |
| RHD*weak D type 12 | weak D type 12 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G277E) | 1999 | 1999 |
| RHD*weak D type 120 | weak D type 120 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A273E) | 2010 | |
| RHD*weak D type 121 | weak D type 121 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(A59D) | 2015 | |
| RHD*weak D type 122 | weak D type 122 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(R70W) | 2011 | |
| RHD*weak D type 123 | weak D type 123 | not reported | weakened D expression weakened D expression | Eurasian D cluster | RHD(V127L) | 2015 | |
| RHD*weak D type 124 | weak D type 124 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(K198N) | 2015 | |
| RHD*weak D type 125 | weak D type 125 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(N224S) | 2015 | |
| RHD*weak D type 126 | weak D type 126 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(K400I) | 2015 | |
| RHD*weak D type 127 | weak D type 127 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(K400N) | 2012 | 2012 |
| RHD*weak D type 128 | weak D type 128 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(D403Y) | 2015 | |
| RHD*weak D type 129 | weak D type 129 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(D403V) | 2012 | 2012 |
| RHD*weak D type 13 | weak D type 13 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A276P) | 1999 | 1999 |
| RHD*weak D type 130 | weak D type 130 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(T55P) | 2011 | 2012 |
| RHD*weak D type 131 | weak D type 131 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A85G) | 2012 | 2012 |
| RHD*weak D type 132 | weak D type 132 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(G132R) | 2010 | 2012 |
| RHD*weak D type 133 | weak D type 133 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(G132E) | 2012 | 2012 |
| RHD*weak D type 134 | weak D type 134 | not reported | weak D type | Eurasian D cluster | RHD(L390V) | 2012 | 2012 |
| RHD*weak D type 135 | weak D type 135 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(M295K) | 2016 | |
| RHD*weak D type 136 | weak D type 136 | not reported | weak D type | Eurasian D cluster | RHD(P14L) | 2016 | |
| RHD*weak D type 137 | weak D type 137 | not reported | weak D type | Eurasian D cluster | RHD(H260Q) | 2016 | |
| RHD*weak D type 138 | weak D type 138 | not reported | weak D type | Eurasian D cluster | RHD(P291S) | 2016 | |
| RHD*weak D type 139 | weak D type 139 | not reported | weak D type | Eurasian D cluster | RHD(L390P) | 2016 | |
| RHD*weak D type 14 | weak D type 14 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(S182T,K198N,T201R) | 1999 | 1999 |
| RHD*weak D type 140 | weak D type 140 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(F410S) | 2016 | 2016 |
| RHD*weak D type 142 | weak D type 142 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A23S) | 2016 | |
| RHD*weak D type 143 | weak D type 143 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(A58V) | 2015 | |
| RHD*weak D type 144 | weak D type 144 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(E193D) | 2016 | |
| RHD*weak D type 145 | weak D type 145 | not reported | Eurasian D cluster | RHD(P14R) | |||
| RHD*weak D type 16 | weak D type 16 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(W220R) | 1999 | 1999 |
| RHD*weak D type 17 | weak D type 17 | CDE | weak D type weakened D expression | Eurasian D cluster | RHD(R114W) | 2000 | 2000 |
| RHD*weak D type 18 | weak D type 18 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R7W) | 2000 | |
| RHD*weak D type 19 | weak D type 19 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(I204T) | 2006 | 2006 |
| RHD*weak D type 2 | weak D type 2 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G385A) | 1999 | 1999 |
| RHD*weak D type 2.1 | weak D type 2.1 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(F101I,G385A) | 2009 | |
| RHD*weak D type 2.2 | weak D type 2.2 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(V306I,Y311C,G385A) | 2014 | 2014 |
| RHD*weak D type 20 | weak D type 20 | cDE | weak D type | Eurasian D cluster | RHD(F417S) | 2000 | 2006 |
| RHD*weak D type 22 | weak D type 22 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(W408C) | 2000 | |
| RHD*weak D type 23 | weak D type 23 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G212C) | 2001 | 2001 |
| RHD*weak D type 24 | weak D type 24 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L338P) | 2003 | 2003 |
| RHD*weak D type 25 | weak D type 25 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R114Q) | 2005 | |
| RHD*weak D type 26 | weak D type 26 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V9D) | 2004 | 2005 |
| RHD*weak D type 27 | weak D type 27 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(P221S) | 2002 | |
| RHD*weak D type 28 | weak D type 28 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(1152A>C) | 2002 | |
| RHD*weak D type 29 | weak D type 29 | cDe | weak D type weakened D expression | weak D type 4 cluster | RHD(I60L,S68N,K198N,F223V,I342T) | 2003 | 2003 |
| RHD*weak D type 3 | weak D type 3 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S3C) | 1999 | 1999 |
| RHD*weak D type 3.1 | weak D type 3.1 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S3C,I60L) | 2014 | 2014 |
| RHD*weak D type 30 | weak D type 30 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E340M) | 2003 | |
| RHD*weak D type 31 | weak D type 31 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(P6L) | 2004 | 2005 |
| RHD*weak D type 32 | weak D type 32 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(I374N) | 2005 | 2005 |
| RHD*weak D type 33 | weak D type 33 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V174M) | 2003 | 2003 |
| RHD*weak D type 34 | weak D type 34 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V270E) | 2003 | 2003 |
| RHD*weak D type 35 | weak D type 35 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G87D) | 2003 | |
| RHD*weak D type 36 | weak D type 36 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V281G) | 2004 | |
| RHD*weak D type 37 | weak D type 37 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(K133N) | 2003 | 2004 |
| RHD*weak D type 38 | weak D type 38 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G278D) | 2003 | 2004 |
| RHD*weak D type 39 | weak D type 39 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G339R) | 2003 | |
| RHD*weak D type 40 | weak D type 40 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(T201R) | 2003 | |
| RHD*weak D type 41 | weak D type 41 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E398V) | 2004 | |
| RHD*weak D type 41.01. | weak D type 41.0.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L390L,E398V) | 2016 | |
| RHD*weak D type 42 | weak D type 42 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(K409M) | 2005 | 2005 |
| RHD*weak D type 43 | weak D type 43 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A202V) | 2006 | 2006 |
| RHD*weak D type 44 | weak D type 44 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Y243C) | 2004 | |
| RHD*weak D type 45 | weak D type 45 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(A399T) | 2004 | |
| RHD*weak D type 46 | weak D type 46 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(F407L) | 2004 | |
| RHD*weak D type 47 | weak D type 47 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R114G) | 2005 | |
| RHD*weak D type 48 | weak D type 48 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G61V) | 2005 | |
| RHD*weak D type 49 | weak D type 49 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S257F) | 2006 | 2007 |
| RHD*weak D type 5 | weak D type 5 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A149D) | 1999 | 1999 |
| RHD*weak D type 50 | weak D type 50 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Y243N) | 2006 | |
| RHD*weak D type 51 | weak D type 51 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD-RHCE(4:594-4:602)-RHD | 2005 | |
| RHD*weak D type 52 | weak D type 52 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(F31S) | 2005 | |
| RHD*weak D type 53 | weak D type 53 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V247G) | 2005 | |
| RHD*weak D type 54 | weak D type 54 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(S122L) | ||
| RHD*weak D type 55 | weak D type 55 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(L299V) | 2007 | |
| RHD*weak D type 56 | weak D type 56 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A22E) | 2007 | 2007 |
| RHD*weak D type 58 | weak D type 58 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G336R) | 2007 | 2007 |
| RHD*weak D type 59 | weak D type 59 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L383P) | 2007 | 2007 |
| RHD*weak D type 6 | weak D type 6 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R10Q) | 1999 | 1999 |
| RHD*weak D type 60 | weak D type 60 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(407delFW) | 2007 | 2007 |
| RHD*weak D type 61 | weak D type 61 | CDe | weak D type weakened D expression DEL | Eurasian D cluster | RHD(R10W) | 2006 | 2006 |
| RHD*weak D type 62 | weak D type 62 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(P221T) | 2006 | |
| RHD*weak D type 63 | weak D type 63 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(I253N) | 2007 | |
| RHD*weak D type 64 | weak D type 64 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A294V) | 2007 | |
| RHD*weak D type 65 | weak D type 65 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(A23D) | 2008 | |
| RHD*weak D type 66 | weak D type 66 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(V306I) | 2007 | |
| RHD*weak D type 67 | weak D type 67 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(T241I) | 2008 | |
| RHD*weak D type 68 | weak D type 68 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(165C>T,1213C>G) | 2006 | |
| RHD*weak D type 69 | weak D type 69 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R318Q) | 2008 | |
| RHD*weak D type 7 | weak D type 7 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G339E) | 1999 | 1999 |
| RHD*weak D type 70 | weak D type 70 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L338V) | 2008 | |
| RHD*weak D type 71 | weak D type 71 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(R10P) | 2009 | |
| RHD*weak D type 72 | weak D type 72 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(D404E) | 2007 | |
| RHD*weak D type 73 | weak D type 73 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A414V) | 2009 | |
| RHD*weak D type 74 | weak D type 74 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(S68T) | 2009 | |
| RHD*weak D type 75 | weak D type 75 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(E398D) | 2010 | |
| RHD*weak D type 76 | weak D type 76 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(Q405H) | 2010 | |
| RHD*weak D type 77 | weak D type 77 | not reported | weakened D expression weak D type | Eurasian D cluster | RHD(S256P) | 2010 | 2011 |
| RHD*weak D type 78 | weak D type 78 | CDe | weakened D expression weak D type | Eurasian D cluster | RHD(F410V) | 2009 | 2011 |
| RHD*weak D type 79 | weak D type 79 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L187P) | 2012 | |
| RHD*weak D type 8 | weak D type 8 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(G307R) | 1999 | 1999 |
| RHD*weak D type 80 | weak D type 80 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(G180E) | 2012 | |
| RHD*weak D type 81 | weak D type 81 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(K400T) | 2012 | |
| RHD*weak D type 82 | weak D type 82 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A395V) | 2012 | |
| RHD*weak D type 83 | weak D type 83 | cDE | weakened D expression | Eurasian D cluster | RHD(L413W) | 2012 | |
| RHD*weak D type 84 | weak D type 84 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(S76N) | 2013 | |
| RHD*weak D type 85 | weak D type 85 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R70Q) | 2010 | |
| RHD*weak D type 86 | weak D type 86 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(V345E) | 2014 | |
| RHD*weak D type 87 | weak D type 87 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(I125N) | 2014 | 2015 |
| RHD*weak D type 88 | weak D type 88 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(G61A) | 2014 | |
| RHD*weak D type 89 | weak D type 89 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(A23P) | 2014 | 2014 |
| RHD*weak D type 9 | weak D type 9 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A294P) | 1999 | 1999 |
| RHD*weak D type 90 | weak D type 90 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(N331K) | 2014 | 2014 |
| RHD*weak D type 91 | weak D type 91 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(P396R) | 2014 | 2014 |
| RHD*weak D type 92 | weak D type 92 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(L382P) | 2014 | 2014 |
| RHD*weak D type 93 | weak D type 93 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A120D) | 2016 | |
| RHD*weak D type 94 | weak D type 94 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(M295T) | 2012 | 2013 |
| RHD*weak D type 95 | weak D type 95 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(A244P) | 2013 | 2013 |
| RHD*weak D type 96 | weak D type 96 | cDe | weak D type weakened D expression | Eurasian D cluster | RHD(A244V) | 2013 | 2013 |
| RHD*weak D type 97 | weak D type 97 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(L181P) | 2013 | 2013 |
| RHD*weak D type 98 | weak D type 98 | cDE | weak D type weakened D expression | Eurasian D cluster | RHD(T251P) | 2013 | 2013 |
| RHD*weak D type 99 | weak D type 99 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(E369D) | 2013 | 2013 |
| RHD*weak partial 11 | RHD(M295I) | CDe | DEL Partial D | Eurasian D cluster | RHD(M295I) | 2001 | 2001 |
| RHD*weak partial 11 | weak D type 11 | cDe | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(M295I) | 1999 | 1999 |
| RHD*weak partial 15 | weak D type 15 | cDE | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(G282D) | 1999 | 1999 |
| RHD*weak partial 57 | weak D type 57 | not reported | weak D type weakened D expression Partial D | Eurasian D cluster | RHD(L214F) | 2007 | 2007 |
| RHD*weak partial D 21 | weak D type 21 | CDe | weak D type Partial D weakened D expression | Eurasian D cluster | RHD(P313L) | 2001 | 2001 |
| RHDÜweak D type 45.1 | weak D type 45.1 | not reported | weak D type weakened D expression | Eurasian D cluster | RHD(A273V,A399T) | 2010 | |
| RHDÜweak D type 45.2 | weak D type 45.2 | CDe | weak D type weakened D expression | Eurasian D cluster | RHD(R70W,A273V,A399T) | 2013 | 2013 |