RHD: Alleles by proposed ISBT name

Note: There are up to three proposed ISBT designations per allele, therefore alleles may appear repeatedly in this list

ISBT nameDesignationHaplotypePhenotypeClusterStructureFirst mentionDefinitive publication
RHD(S68T)weak D type 74not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
RHD* 01W.100weak D type 100CDeweak D type
weakened D expression
Eurasian D clusterRHD(G263R)2010
RHD* 01W.101weak D type 101not reportedweakened D expression
weak D type
Eurasian D clusterRHD(E21A)2015
RHD* 01W.102weak D type 102multipleweakened D expression
weak D type
Eurasian D clusterRHD(I25F)2016
RHD* 01W.103weak D type 103not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F31I)2015
RHD* 01W.104RHD(D53Y)not reportedweakened D expressionEurasian D clusterRHD(D53Y)2015
RHD* 01W.105weak D type 105not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S67W)20152015
RHD* 01W.106weak D type 106cDEweak D type
weakened D expression
Eurasian D clusterRHD(W74G)20152015
RHD* 01W.107weak D type 107not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S75C)2015
RHD* 01W.108RHD(G96D)not reportedweakened D expressionEurasian D clusterRHD(G96D)20152015
RHD* 01W.109weak D type 109not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S126P)2015
RHD* 01W.110weak D type 110not reportedweakened D expression
weak D type
Eurasian D clusterRHD(Q138R)20152015
RHD* 01W.111weak D type 111not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212S)2015
RHD* 01W.112weak D type 112not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212D)20152015
RHD* 01W.113weak D type 113not reportedweak D type
weakened D expression
Eurasian D clusterRHD(W292R)2015
RHD* 01W.114weak D type 114not reportedweakened D expression
weak D type
Eurasian D clusterRHD(P323L)20152015
RHD* 01W.115weak D type 115CDeweakened D expression
weak D type
Eurasian D clusterRHD(M328K)20152015
RHD* 01W.116weak D type 116not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116P)20152015
RHD* 01W.117weak D type 117not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116T)2015
RHD* 01W.118weak D type 118not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116V)2010
RHD* 01W.119weak D type 119CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273V)2010
RHD* 01W.120weak D type 120CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273E)2010
RHD* 01W.121weak D type 121not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A59D)2015
RHD* 01W.122weak D type 122not reportedweakened D expression
weak D type
Eurasian D clusterRHD(R70W)2011
RHD* 01W.123weak D type 123not reportedweakened D expression
weakened D expression
Eurasian D clusterRHD(V127L)2015
RHD* 01W.124weak D type 124not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K198N)2015
RHD* 01W.125weak D type 125not reportedweakened D expression
weak D type
Eurasian D clusterRHD(N224S)2015
RHD* 01W.126weak D type 126not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K400I)2015
RHD* 01W.127weak D type 127not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K400N)20122012
RHD* 01W.128weak D type 128not reportedweakened D expression
weak D type
Eurasian D clusterRHD(D403Y)2015
RHD* 01W.129weak D type 129CDeweakened D expression
weak D type
Eurasian D clusterRHD(D403V)20122012
RHD* 01W.130weak D type 130CDeweakened D expression
weak D type
Eurasian D clusterRHD(T55P)20112012
RHD* 01W.131weak D type 131CDeweakened D expression
weak D type
Eurasian D clusterRHD(A85G)20122012
RHD* 01W.132weak D type 132CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132R)20102012
RHD* 01W.133weak D type 133CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132E)20122012
RHD* 01W.134weak D type 134not reportedweak D typeEurasian D clusterRHD(L390V)20122012
RHD* 01W.135weak D type 135not reportedweak D type
weakened D expression
Eurasian D clusterRHD(M295K)2016
RHD* 01W.136weak D type 136not reportedweak D typeEurasian D clusterRHD(P14L)2016
RHD* 01W.137weak D type 137not reported
weak D type
Eurasian D clusterRHD(H260Q)2016
RHD* 01W.138weak D type 138not reportedweak D typeEurasian D clusterRHD(P291S)2016
RHD* 01W.139weak D type 139not reported
weak D type
Eurasian D clusterRHD(L390P)2016
RHD* 01W.140weak D type 140not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F410S)20162016
RHD* 01W.141weak D type 141cDePartial D
weakened D expression
weak D type
Eurasian D clusterRHD(F223S)20152016
RHD* 01W.142weak D type 142CDeweakened D expression
weak D type
Eurasian D clusterRHD(A23S)2016
RHD* 01W.143weak D type 143CDeweakened D expression
weak D type
Eurasian D clusterRHD(A58V)2015
RHD* 01W.144weak D type 144CDeweakened D expression
weak D type
Eurasian D clusterRHD(E193D)2016
RHD* 01W.145weak D type 145not reportedEurasian D clusterRHD(P14R)
RHD* 01W.73weak D type 73not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A414V)2009
RHD* 01W.74weak D type 74not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
RHD* 01W.75weak D type 75not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398D)2010
RHD* 01W.76weak D type 76not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Q405H)2010
RHD* 01W.77weak D type 77not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S256P)20102011
RHD* 01W.78weak D type 78CDeweakened D expression
weak D type
Eurasian D clusterRHD(F410V)20092011
RHD* 01W.79weak D type 79not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L187P)2012
RHD* 01W.80weak D type 80not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G180E)2012
RHD* 01W.81weak D type 81CDeweak D type
weakened D expression
Eurasian D clusterRHD(K400T)2012
RHD* 01W.82weak D type 82CDeweak D type
weakened D expression
Eurasian D clusterRHD(A395V)2012
RHD* 01W.83weak D type 83cDEweakened D expressionEurasian D clusterRHD(L413W)2012
RHD* 01W.84weak D type 84CDeweak D type
weakened D expression
Eurasian D clusterRHD(S76N)2013
RHD* 01W.85weak D type 85CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70Q)2010
RHD* 01W.86weak D type 86not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V345E)2014
RHD* 01W.87weak D type 87not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I125N)20142015
RHD* 01W.88weak D type 88cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61A)2014
RHD* 01W.89weak D type 89CDeweak D type
weakened D expression
Eurasian D clusterRHD(A23P)20142014
RHD* 01W.90weak D type 90CDeweak D type
weakened D expression
Eurasian D clusterRHD(N331K)20142014
RHD* 01W.91weak D type 91CDeweak D type
weakened D expression
Eurasian D clusterRHD(P396R)20142014
RHD* 01W.92weak D type 92not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P)20142014
RHD* 01W.93weak D type 93cDEweak D type
weakened D expression
Eurasian D clusterRHD(A120D)2016
RHD* 01W.94weak D type 94CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
RHD* 01W.95weak D type 95cDEweak D type
weakened D expression
Eurasian D clusterRHD(A244P)20132013
RHD* 01W.96weak D type 96cDeweak D type
weakened D expression
Eurasian D clusterRHD(A244V)20132013
RHD* 01W.97weak D type 97CDeweak D type
weakened D expression
Eurasian D clusterRHD(L181P)20132013
RHD* 01W.98weak D type 98cDEweak D type
weakened D expression
Eurasian D clusterRHD(T251P)20132013
RHD* 01W.99weak D type 99CDeweak D type
weakened D expression
Eurasian D clusterRHD(E369D)20132013
RHD* DIV.3DIV type 3CDePartial D
D category
Eurasian D clusterRHD-RHCE(6-9)-RHD19991999
RHD* DIVbDIVb type 2CDePartial DEurasian D clusterRHD-RHCE(7:1048-9)-RHD19951995
RHD*01standard RHDmultipleD positive (apparently normal)Eurasian D clusterRHD
RHD*01.01DUC-3CDeD positive (apparently normal)Eurasian D clusterRHD(W16C)2010
RHD*01EL.01RHD(1227G>A)CDeDELEurasian D clusterRHD(1227G>A)20012001
RHD*01EL.02RHD(M1I)not reportedDELEurasian D clusterRHD(M1I)20062006
RHD*01EL.03RHD(L18P)not reportedDELEurasian D clusterRHD(L18P)20062006
RHD*01EL.04RHD(147del A)CDeDELEurasian D clusterRHD(147del A)20042009
RHD*01EL.05RHD(IVS1+1G>A)not reportedDELEurasian D clusterRHD(IVS1+1G>A)2001
RHD*01EL.06RHD(L84P)not reportedDELEurasian D clusterRHD(L84P)20062006
RHD*01EL.07RHD(A137E)CDeDELEurasian D clusterRHD(A137E)20062009
RHD*01EL.08RHD(IVS3+1G>A)CDeDEL
D negative
Eurasian D clusterRHD(IVS3+1G>A)20012001
RHD*01EL.09RHD(IVS3+2T>A)cDED negativeEurasian D clusterRHD(IVS3+2T>A)20082009
RHD*01EL.10RHD(W408R)CDeDELEurasian D clusterRHD(W408R)20052005
RHD*01EL.11RHD(X418L)CDeDELEurasian D clusterRHD(X418L)20052005
RHD*01EL.12RHD(L153P)cDEDELEurasian D clusterRHD(L153P)20042009
RHD*01EL.13RHD(786del A)CDeD negativeEurasian D clusterRHD(785del A)20042009
RHD*01EL.14RHD(IVS4+5G>T)CDeweakened D expressionEurasian D clusterRHD(IVS4+5G>T)20102013
RHD*01EL.15RHD(G308X)CDeD negativeEurasian D clusterRHD(G308X)2010
RHD*01EL.16RHD(G212R)cDeDELEurasian D clusterRHD(G212R)20082009
RHD*01EL.17RHD(Y401X)cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD*01EL.18RHD(93insT)CDeDEL
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD*01EL.19RHD(IVS4-2A>G)not reportedweakened D expressionEurasian D clusterRHD(IVS4-2A>G)20102011
RHD*01EL.20RHD(IVS8-8T>A)not reportedweakened D expressionEurasian D clusterRHD(IVS8-8T>A)20072007
RHD*01EL.21RHD(IVS1+5G>C)not reportedDELEurasian D clusterRHD(IVS1+5G>C)2013
RHD*01EL.22RHD(IVS2-2delA)not reportedDEL
Partial D
Eurasian D clusterRHD(IVS2-2delA)2013
RHD*01EL.23DBUcDEDEL
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
RHD*01EL.24DEL RHD(A280T)not reportedDELEurasian D clusterRHD(A280T)20142014
RHD*01EL.25DEL RHD(X418K)CDeDELEurasian D clusterRHD(X418K)20152015
RHD*01EL.26RHD(1248insG)CDeDELEurasian D clusterRHD(1248insG)20142014
RHD*01EL.28RHD(993delC)not reportedEurasian D clusterRHD(993delC)2014
RHD*01EL.29RHD(D404H)cDEDELEurasian D clusterRHD(D404H)2012
RHD*01EL.30RHD(del Ex8)not reportedDELEurasian D clusterRHD(del Ex8)20072007
RHD*01EL.31RHD(IVS1+1G>T)cDEDELEurasian D clusterRHD(1481G>T)20142014
RHD*01EL.32RHD(IVS1-29G>C)CDeDELEurasian D clusterRHD(IVS1-29G>C)2012
RHD*01EL.33RHD(IVS2-2A>G)not reportedDELEurasian D clusterRHD(IVS2-2A>G)20112011
RHD*01EL.36RHD(IVS7+152C>A,1227G>A)CDeDELEurasian D clusterRHD(IVS7+152C>A,1227G>A)20022002
RHD*01EL.37RHD(IVS8-31C>T)not reportedDELEurasian D clusterRHD(IVS8-31C>T)2012
RHD*01EL.38RHD(L337R)CDeD negative
DEL
Eurasian D clusterRHD(L337R)20142014
RHD*01EL.39RHD(L38X)not reportedDELEurasian D clusterRHD(L38X)2010
RHD*01EL.40RHD(L93R)CDeDELEurasian D clusterRHD(L93R)20142014
RHD*01EL.41RHD(P291R)CDeDELEurasian D clusterRHD(P291R)2012
RHD*01EL.42RHD(S112T)not reportedDELEurasian D clusterRHD(S112T)2012
RHD*01EL.43RHD(W16R)cDEDELEurasian D clusterRHD(W16R)2012
RHD*01EL.44RHD-RHCE(4-9)-RHDCDeDELEurasian D clusterRHD-RHCE(4-9)-RHD20092009
RHD*01EL.45RHD(T241P)not reportedEurasian D clusterRHD(T241P)
RHD*01EL.46weak D type 94CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
RHD*01N.01RHD deletioncdeD negativeno RHDRHD(del exon 1 to 10)19911991
RHD*01N.02RHCE(1-9)-RHDcDED negativeEurasian D clusterRHCE(1-9)-RHD20012001
RHD*01N.03RHD-RHCe(2-9)-RHDCDeD negativeEurasian D clusterRHD-RHCe(2-9)-RHD19961996
RHD*01N.04RHD(S68T)-RHCe(3-9)-RHDCDeD negativeEurasian D clusterRHD(S68T)-RHCE(3-9)-RHD20052005
RHD*01N.05RHD-RHCe(2-7)-RHDCDeD negativeEurasian D clusterRHD-RHCE(3-7)-RHD20012001
RHD*01N.06Ccdes-2CcdeD negativeDIVa clusterRHD-RHCE(4-7)-RHD(G336C)20092009
RHD*01N.07RHD-RHCE(4-7)-RHDcDED negative
DEL
Eurasian D clusterRHD-RHCE(4-7)-RHD19961996
RHD*01N.07RHD-RHCE(4-7)-RHD1cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD*01N.07RHD-RHCE(4-7)-RHD2cDED negativeEurasian D clusterRHD-RHCE(4-7)-RHD
RHD*01N.07RHD-RHCE(4-8)-RHDCDeD negativeEurasian D clusterRHD-RHCE(4-7)-RHD20052005
RHD*01N.08RHD(W16X)CDeD negativeEurasian D clusterRHD(W16X)20012001
RHD*01N.09RHD(Q41X)CDeD negativeEurasian D clusterRHD(Q41X)19971997
RHD*01N.10RHD(W90X)CDeD negativeEurasian D clusterRHD(W90X)20022002
RHD*01N.11RHD(325delA)CDeD negativeEurasian D clusterRHD(325del A)20072007
RHD*01N.12RHD(449del T)CDeD negativeEurasian D clusterRHD(449del T)2004
RHD*01N.13RHD(489delAGAC)CDeD negativeEurasian D clusterRHD(487del ACAG)19981998
RHD*01N.14RHD(W185X)CDeD negativeEurasian D clusterRHD(W185X)20052005
RHD*01N.15RHD(G212V)CDeD negativeEurasian D clusterRHD(G212V)20012001
RHD*01N.16RHD(711del C)cDED negativeEurasian D clusterRHD(711del C)20022002
RHD*01N.17RHD(652delA 653T>G)not reportedD negativeEurasian D clusterRHD(652delA 653T>G)2006
RHD*01N.18RHD(Y269X)CDeD negativeEurasian D clusterRHD(Y269X)20042009
RHD*01N.19RHD(Y311X)[933A]CDeD negativeEurasian D clusterRHD(Y311X)20052005
RHD*01N.20RHD(G314V)CDeD negativeEurasian D clusterRHD(G314V)19971997
RHD*01N.21RHD(Y330X)CDeD negativeEurasian D clusterRHD(Y330X)20012001
RHD*01N.22RHD(Y401X)cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD*01N.23RHD(343del C)CDeD negativeEurasian D clusterRHD(343del C)20042009
RHD*01N.24RHD(IVS2+1G>A)not reportedD negativeEurasian D clusterRHD(IVS2+1G>A)20072007
RHD*01N.25RHD(IVS2-1G>A)CDeD negativeEurasian D clusterRHD(IVS2-1G>A)20052005
RHD*01N.26RHD(IVS8+1G>A)CDeD negativeEurasian D clusterRHD(IVS8+1G>A)20012001
RHD*01N.27RHD(909ins TGGCT, IVS6+2del TAAG)CDeD negativeEurasian D clusterRHD(909ins TGGCT, IVS6+2del TAAG)20022002
RHD*01N.28RHD(970delCAC,976delTCCATCATGGGCTACA)CDeD negativeEurasian D clusterRHD(970delCAC,976delTCCATCATGGGCTACA)20082009
RHD*01N.29RHD(660delG)CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*01N.30RHD*745_757delnot reportedD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA)
RHD*01N.32RHD(78delC)CDeD negativeEurasian D clusterRHD(78delC)20092010
RHD*01N.33RHD(712delG)CDeD negativeEurasian D clusterRHD(712delG)20082009
RHD*01N.34RHD(615delCA)CDeD negativeEurasian D clusterRHD(615delCA)20092012
RHD*01N.35RHD(330delGT)not reportedD negativeEurasian D clusterRHD(330delGT)20072007
RHD*01N.36RHD(1080del10)not reportedD negativeEurasian D clusterRHD(1080del10)2010
RHD*01N.37RHD(297del23)not reportedD negativeEurasian D clusterRHD(297del23)2013
RHD*01N.38RHD(IVS6+2T>A)not reportedD negativeEurasian D clusterRHD(IVS6+2T>A)2013
RHD*01N.39RHD(S256X)CDeD negativeEurasian D clusterRHD(S256X)20122013
RHD*01N.40RHD(Y343X)cDED negativeEurasian D clusterRHD(Y343X)20122013
RHD*01N.41RHD(361del11)CDeD negativeEurasian D clusterRHD(361del11)20142014
RHD*01N.42RHCE(1)-D(6)-CE(7-10)CdeD negativeno RHDRHCE(1)-RHD(6)-RHCE(7-10)20022002
RHD*01N.43RHCE(1-3)-RHD(4-10)cDED negativeEurasian D clusterRHD(Hybrid RHCE(1-3))20042009
RHD*01N.44RHD(1228-2del21)not reportedD negativeEurasian D clusterRHD(1228-2del21)2014
RHD*01N.45RHD(216dupCA,1195G>A)CDeD negativeEurasian D clusterRHD(216dupCA,1195G>A)2012
RHD*01N.46RHD(545delCTGT)cDeD negativeEurasian D clusterRHD(545delCTGT)20122012
RHD*01N.47RHD(745del13)CDeD negativeEurasian D clusterRHD(745delGTGGTGACAGCCA,758TC>AG)2008
RHD*01N.48RHD(822delG)not reportedD negativeEurasian D clusterRHD(822delG)2014
RHD*01N.49RHD(915delC)not reportedD negativeEurasian D clusterRHD(915delC)20142014
RHD*01N.50RHD(93insT)CDeDEL
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD*01N.51RHD(950delA)not reportedD negativeEurasian D clusterRHD(950delA)2012
RHD*01N.52RHD(G308X)CDeD negativeEurasian D clusterRHD(G308X)2010
RHD*01N.53RHD(G385D)not reportedD negativeEurasian D clusterRHD(G385D)20142014
RHD*01N.54RHD(IVS5+1G>A)not reportedD negativeEurasian D clusterRHD(IVS5+1G>A)2012
RHD*01N.55RHD(IVS6+1G>A)CDeD negativeEurasian D clusterRHD(IVS6+1G>A)20142014
RHD*01N.56RHD(IVS7+2T>C)not reportedD negativeEurasian D clusterRHD(IVS7+2T>C)2012
RHD*01N.57RHD(L337R)CDeD negative
DEL
Eurasian D clusterRHD(L337R)20142014
RHD*01N.58RHD(IVS5-38del tctc)not reportedDELEurasian D clusterRHD(IVS5-38del tctc)20052005
RHD*01N.59RHD(Q200X)not reportedD negativeEurasian D clusterRHD(Q200X)2011
RHD*01N.60RHD(Q405X)not reportedD negativeEurasian D clusterRHD(Q405X)2015
RHD*01N.61RHD(R318X)CDeD negativeEurasian D clusterRHD(R318X)20082009
RHD*01N.62RHD(S254X)CDeD negativeEurasian D clusterRHD(S254X)20152015
RHD*01N.63RHD(Y311X)[761G]not reportedD negativeEurasian D clusterRHD(Y311X)
RHD*01N.64RHD(Q362X)not reportedD negativeEurasian D clusterRHD(Q362X)
RHD*01N.65RHD(124delAA)not reportedEurasian D clusterRHD(124delAA)
RHD*01N.66RHD(1174delA)not reportedEurasian D clusterRHD(1174delA)
RHD*01N.67RHD(delEx1)not reportedD negativeEurasian D clusterRHD(2-10)
RHD*01N.68RHD(S112I)not reportedEurasian D clusterRHD(S112I)2012
RHD*01N.69RHD(IVS4+1G>T,1136C>T)not reportedD negativeDAU clusterRHD(IVS4+1G>T,1136C>T)
RHD*01N.70RHD(IVS7+1G>T)not reportedD negativeEurasian D clusterRHD(IVS7+1G>T)
RHD*01N.71RHD(IVS7-1G>A)not reportedEurasian D clusterRHD(IVS7-1G>A)
RHD*01N.72RHD-RHCE(3)--weak D type 4.0not reportedD negativeweak D type 4 clusterRHD-RHCE(3)-RHD(T201R,F223V,819G>A)
RHD*01N.73RHD(T148R)not reportedD negativeEurasian D clusterRHD(T148R)20122012
RHD*01N.74RHD(142delM)not reportedD negativeEurasian D clusterRHD(142delM)
RHD*01N.75RHD(581insG)not reportedEurasian D clusterRHD(581insG)
RHD*01N.76RHD(W393X)not reportedEurasian D clusterRHD(W393X)20142014
RHD*01N.77RHD(IVS9-1G>A)CDeEurasian D clusterRHD(IVS9-1G>A)20142014
RHD*01N.78RHD(660delG)CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*01N.79RHD(L299P)not reportedEurasian D clusterRHD(L299P)2011
RHD*01N.80RHD(G336D)not reportedD negativeEurasian D clusterRHD(G336D)2011
RHD*01N.81RHD(IVS7-2A>C)not reportedEurasian D clusterRHD(IVS7-2A>C)2011
RHD*01N.82RHD(697delG)not reportedD negativeEurasian D clusterRHD(697delG)
RHD*01N.83RHD(702delG)not reportedD negativeEurasian D clusterRHD(702delG)2017
RHD*01W.1weak D type 1CDeweak D type
weakened D expression
Eurasian D clusterRHD(V270G)19991999
RHD*01W.1.1weak D type 1.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(L18V,V270G)20042005
RHD*01W.10weak D type 10cDEweak D type
weakened D expression
Eurasian D clusterRHD(W393R)19991999
RHD*01W.10.1weak D type 10.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P,W393R)2016
RHD*01W.10.2weak D type 10.2not reportedweakened D expression
weak D type
Eurasian D clusterRHD(W393R,K400T)20152016
RHD*01W.12weak D type 12CDeweak D type
weakened D expression
Eurasian D clusterRHD(G277E)19991999
RHD*01W.13weak D type 13CDeweak D type
weakened D expression
Eurasian D clusterRHD(A276P)19991999
RHD*01W.14weak D type 14cDEweak D type
weakened D expression
Eurasian D clusterRHD(S182T,K198N,T201R)19991999
RHD*01W.16weak D type 16cDEweak D type
weakened D expression
Eurasian D clusterRHD(W220R)19991999
RHD*01W.17weak D type 17CDEweak D type
weakened D expression
Eurasian D clusterRHD(R114W)20002000
RHD*01W.18weak D type 18not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R7W)2000
RHD*01W.19weak D type 19cDeweak D type
weakened D expression
Eurasian D clusterRHD(I204T)20062006
RHD*01W.2weak D type 2cDEweak D type
weakened D expression
Eurasian D clusterRHD(G385A)19991999
RHD*01W.2.1weak D type 2.1cDEweak D type
weakened D expression
Eurasian D clusterRHD(F101I,G385A)2009
RHD*01W.2.2weak D type 2.2cDEweak D type
weakened D expression
Eurasian D clusterRHD(V306I,Y311C,G385A)20142014
RHD*01W.20weak D type 20cDEweak D typeEurasian D clusterRHD(F417S)20002006
RHD*01W.22weak D type 22CDeweak D type
weakened D expression
Eurasian D clusterRHD(W408C)2000
RHD*01W.23weak D type 23not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G212C)20012001
RHD*01W.24weak D type 24not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L338P)20032003
RHD*01W.25weak D type 25not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114Q)2005
RHD*01W.26weak D type 26CDeweak D type
weakened D expression
Eurasian D clusterRHD(V9D)20042005
RHD*01W.27weak D type 27not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221S)2002
RHD*01W.28weak D type 28not reportedweak D type
weakened D expression
Eurasian D clusterRHD(1152A>C)2002
RHD*01W.29weak D type 29cDeweak D type
weakened D expression
weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,I342T)20032003
RHD*01W.3weak D type 3CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C)19991999
RHD*01W.3.1weak D type 3.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C,I60L)20142014
RHD*01W.30weak D type 30not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E340M)2003
RHD*01W.31weak D type 31CDeweak D type
weakened D expression
Eurasian D clusterRHD(P6L)20042005
RHD*01W.32weak D type 32CDeweak D type
weakened D expression
Eurasian D clusterRHD(I374N)20052005
RHD*01W.33weak D type 33CDeweak D type
weakened D expression
Eurasian D clusterRHD(V174M)20032003
RHD*01W.34weak D type 34not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V270E)20032003
RHD*01W.35weak D type 35not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G87D)2003
RHD*01W.36weak D type 36not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V281G)2004
RHD*01W.37weak D type 37not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K133N)20032004
RHD*01W.38weak D type 38CDeweak D type
weakened D expression
Eurasian D clusterRHD(G278D)20032004
RHD*01W.39weak D type 39CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339R)2003
RHD*01W.40weak D type 40not reportedweak D type
weakened D expression
Eurasian D clusterRHD(T201R)2003
RHD*01W.41weak D type 41not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398V)2004
RHD*01W.42weak D type 42not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(K409M)20052005
RHD*01W.43weak D type 43CDeweak D type
weakened D expression
Eurasian D clusterRHD(A202V)20062006
RHD*01W.44weak D type 44not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243C)2004
RHD*01W.45weak D type 45not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(A399T)2004
RHD*01W.46weak D type 46not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F407L)2004
RHD*01W.47weak D type 47not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114G)2005
RHD*01W.48weak D type 48cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61V)2005
RHD*01W.49weak D type 49CDeweak D type
weakened D expression
Eurasian D clusterRHD(S257F)20062007
RHD*01W.5weak D type 5cDEweak D type
weakened D expression
Eurasian D clusterRHD(A149D)19991999
RHD*01W.50weak D type 50not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243N)2006
RHD*01W.51weak D type 51not reportedweak D type
weakened D expression
Eurasian D clusterRHD-RHCE(4:594-4:602)-RHD2005
RHD*01W.52weak D type 52not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F31S)2005
RHD*01W.53weak D type 53CDeweak D type
weakened D expression
Eurasian D clusterRHD(V247G)2005
RHD*01W.54weak D type 54cDEweak D type
weakened D expression
Eurasian D clusterRHD(S122L)
RHD*01W.55weak D type 55cDEweak D type
weakened D expression
Eurasian D clusterRHD(L299V)2007
RHD*01W.56weak D type 56not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A22E)20072007
RHD*01W.58weak D type 58CDeweak D type
weakened D expression
Eurasian D clusterRHD(G336R)20072007
RHD*01W.59weak D type 59not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L383P)20072007
RHD*01W.6weak D type 6CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10Q)19991999
RHD*01W.60weak D type 60not reportedweak D type
weakened D expression
Eurasian D clusterRHD(407delFW)20072007
RHD*01W.61weak D type 61CDeweak D type
weakened D expression
DEL
Eurasian D clusterRHD(R10W)20062006
RHD*01W.62weak D type 62not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221T)2006
RHD*01W.63weak D type 63not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I253N)2007
RHD*01W.64weak D type 64not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A294V)2007
RHD*01W.65weak D type 65cDeweak D type
weakened D expression
Eurasian D clusterRHD(A23D)2008
RHD*01W.66weak D type 66CDeweak D type
weakened D expression
Eurasian D clusterRHD(V306I)2007
RHD*01W.67weak D type 67cDEweak D type
weakened D expression
Eurasian D clusterRHD(T241I)2008
RHD*01W.68weak D type 68not reportedweak D type
weakened D expression
Eurasian D clusterRHD(165C>T,1213C>G)2006
RHD*01W.69weak D type 69not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R318Q)2008
RHD*01W.7weak D type 7CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339E)19991999
RHD*01W.70weak D type 70CDeweak D type
weakened D expression
Eurasian D clusterRHD(L338V)2008
RHD*01W.71weak D type 71not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R10P)2009
RHD*01W.72weak D type 72not reportedweak D type
weakened D expression
Eurasian D clusterRHD(D404E)2007
RHD*01W.8weak D type 8CDeweak D type
weakened D expression
Eurasian D clusterRHD(G307R)19991999
RHD*01W.9weak D type 9cDEweak D type
weakened D expression
Eurasian D clusterRHD(A294P)19991999
RHD*01w.1.2weak D type 1.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(V238M,V270G)20142014
RHD*01w.41.0.1weak D type 41.0.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L390L,E398V)2016
RHD*01w.45.1weak D type 45.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A273V,A399T)2010
RHD*01w.45.2weak D type 45.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70W,A273V,A399T)20132013
RHD*02DIICDePartial D
D category
Eurasian D clusterRHD(A354D)19971997
RHD*03.01DIII type 5cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,T201R,F223V)
RHD*03.03DIIIcCDePartial D
D category
Eurasian D clusterRHD-RHCE(3)-RHD19961996
RHD*03.04DIII type 4CDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T)20002000
RHD*03.04.02DIII type 4.2not reportedEurasian D clusterRHD(L62F,S103P,A137V,N152T)
RHD*03.06DIII type 6cDePartial D
D category
DIVa clusterRHD(A137V,N152T,T201R,F223V,A273A)20052006
RHD*03.07DIII type 7cDePartial D
D category
DIVa clusterRHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)20052006
RHD*03.08DIII type 8not reportedPartial D
D category
DIVa clusterRHD(A137V,N152T)2010
RHD*03.09DIII type 9not reportedPartial DDIVa clusterRHD(L62F,A137V,N152T,F223V)
RHD*03N.01Ccdes-1CcdeD negativeDIVa clusterRHD(L62F,A137V,N152T)-RHCE(4-7)-RHD(G336C)20042004
RHD*04.01DIV type 1.0cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,D350H)2012
RHD*04.01.02DIVa-likenot reportedEurasian D clusterRHD(L62F,A137V,N152T,F223V,D350H)
RHD*04.03DIV type 3CDePartial D
D category
Eurasian D clusterRHD-RHCE(6-9)-RHD19991999
RHD*04.04DIV type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(7:1048-7:1061)-RHD1998
RHD*04.05DIV type 5cDEPartial D
D category
Eurasian D clusterRHD-RHCE(7-9)-RHD20002000
RHD*04.06DIVb type 2CDePartial DEurasian D clusterRHD-RHCE(7:1048-9)-RHD19951995
RHD*05.01DV type 1CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:697)-RHD19951995
RHD*05.02DV type 2CDePartial D
D category
Eurasian D clusterRHD-RHCE(5)-RHD19951995
RHD*05.03DBS-0CDePartial DEurasian D clusterRHD-RHcE(5:667-5:712)-RHD19961996
RHD*05.04DV type 4CDePartial D
D category
Eurasian D clusterRHD(E233Q)19981999
RHD*05.05DHKCDePartial DEurasian D clusterRHD(E233K)19981999
RHD*05.06DV type 6CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:712)-RHD19981999
RHD*05.07DV type 7CDeD category
Partial D
Eurasian D clusterRHD-RHCE(5:667-5:787)-RHD20012001
RHD*05.08DV type 8CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:744)-RHD19981999
RHD*05.09DV type 9CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:697-5:712)-RHD19992000
RHD*05.10DV type 10not reportedPartial DEurasian D clusterRHD-RHCE(5-6)-RHD
RHD*06.01DVI type 1cDED category
Partial D
Eurasian D clusterRHD-RHcE(4-5)-RHD19971997
RHD*06.02DVI type 2CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(4-6)-RHD19941994
RHD*06.03DVI type 3CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(3-6)-RHD19981998
RHD*06.03.02DVI type 3.2not reportedPartial DEurasian D clusterRHD-RHCE(3-6)-RHD(A399T)
RHD*06.04DVI type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(3-5)-RHD20002006
RHD*07.01DVIICDePartial D
D category
Eurasian D clusterRHD(L110P)19951995
RHD*07.02DVII type 2CDePartial DEurasian D clusterRHD(S103P,L110P)20012001
RHD*08.01DFVmultiplePartial Dweak D type 4 clusterRHD(F223V)20022002
RHD*08N.01RHD psicDeD negativeweak D type 4 clusterRHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)20002000
RHD*09. 05weak D type 4.3cDeweak D type
DEL
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V,P291R)[819G>A]2004
RHD*09.01DAR(T203A)cDePartial Dweak D type 4 clusterRHD(T201R,T203A,F223V,I342T)20122012
RHD*09.01.00DAR1 (weak D type 4.2.0)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)19981999
RHD*09.01.01weak D type 4.2.1 (DAR1.1)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
RHD*09.01.02weak D type 4.2.2 (DAR1.2)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C>T,957G>A]20002000
RHD*09.01.03weak D type 4.2.3 (DAR1.3)cDeweak D type
Partial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C]2008
RHD*09.02DAR-EcDePartial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[957G>A]20062006
RHD*09.02.01DAR2.1not reportedPartial Dweak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]
RHD*09.03weak D type 4.0.1cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)
RHD*09.03.01weak D type 4.0cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)[819G>A]19991999
RHD*09.04weak D type 4.1cDeweak D type
weakened D expression
weak D type 4 clusterRHD(W16C,T201R,F223V)20002000
RHD*09.06DAR(CE2:V50V-S68N)cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
RHD*10.00DAU-0cDeD positive (apparently normal)
Partial D
DAU clusterRHD(T379M)20022002
RHD*10.00.01DAU-0.1cDeDAU clusterRHD(579G>A,1136C>T)20032003
RHD*10.00.02DAU-0.2not reportedEurasian D clusterRHD(150T>C,1136C>T)
RHD*10.01DAU-1cDePartial DDAU clusterRHD(S230I,T379M)20022002
RHD*10.02DAU-2cDePartial D
weakened D expression
DAU clusterRHD(R70Q,S333N,T379M)20022002
RHD*10.03DAU-3cDePartial DDAU clusterRHD(V279M,T379M)20022002
RHD*10.04DAU-4cDePartial D
weakened D expression
DAU clusterRHD(E233K,T379M)20022002
RHD*10.05DAU-5cDePartial DDAU clusterRHD(F223V,E233Q,T379M)20052005
RHD*10.05.01DAU-5.1cDeweakened D expressionDAU clusterRHD(F223V,E233Q,T379M)[1122C>T]20142016
RHD*10.06DAU-6cDePartial DDAU clusterRHD(S333N,T379M)20052005
RHD*10.07DAU-7cDePartial DDAU clusterRHD(V279M,S333N,T379M)20092009
RHD*10.08DAU-8not reportedD positive (no further data)DAU clusterRHD(R114W,T379M)[579G>A]20122012
RHD*10.09DAU-9not reportedD positive (no further data)DAU clusterRHD(F179L,T379M)20122012
RHD*10.10DAU-10not reportedD positive (no further data)DAU clusterRHD(V247L,T379M)[579G>A]20122012
RHD*10.11DAU-11cDeweakened D expressionDAU clusterRHD(A85V,V279M,T379M)20122016
RHD*10.12DAU-12cDeDAU clusterRHD(L181P,T379M)2012
RHD*10.13DAU-13cDeDAU clusterRHD(W16C,T379M)2013
RHD*10.14DAU-14cDeD positive (no further data)DAU clusterRHD(S68N,T379M)[201G>A]20142014
RHD*10.15RHD(M1V,T379M)not reportedDAU clusterRHD(M1V,T379M)2008
RHD*1007ARHD(G336D)not reportedD negativeEurasian D clusterRHD(G336D)2011
RHD*1074-2CRHD(IVS7-2A>C)not reportedEurasian D clusterRHD(IVS7-2A>C)2011
RHD*11RHD(M295I)CDeDEL
Partial D
Eurasian D clusterRHD(M295I)20012001
RHD*11weak D type 11cDeweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(M295I)19991999
RHD*1179ARHD(W393X)not reportedEurasian D clusterRHD(W393X)20142014
RHD*12.01DOL-1cDePartial Dweak D type 4 clusterRHD(M170T,F223V)19992009
RHD*12.02DOL-2not reportedPartial Dweak D type 4 clusterRHD(M170T,F223V,L378V)20052009
RHD*12.03DOL-3not reportedPartial Dweak D type 4 clusterRHD(A137V,M170T,F223V)2005
RHD*12.04DOL-4not reportedPartial DDIVa cluster
RHD*1228-1ARHD(IVS9-1G>A)CDeEurasian D clusterRHD(IVS9-1G>A)20142014
RHD*13.01DBS-1cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:800)-RHD20012001
RHD*13.02DBS-2cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
RHD*14.01DBT-1CDePartial DEurasian D clusterRHD-RHCe(5-7)-RHD19961996
RHD*14.02DBT-2CDePartial DEurasian D clusterRHD-RHCe(5-9)-RHD19991999
RHD*15weak D type 15cDEweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(G282D)19991999
RHD*16.01DCS-1cDEPartial DEurasian D clusterRHD(F223V,A226P)19992008
RHD*16.02DCS-2cDEPartial DEurasian D clusterRHD(A226P)20082008
RHD*16.03DBS-2cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
RHD*17.01DFR-1multiplePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD19951995
RHD*17.02DFR-2CDePartial DEurasian D clusterRHD-RHCE(4)-RHD19971997
RHD*17.03DFR-3CDePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD(G180A)20072007
RHD*17.04DFR-4CDePartial DEurasian D clusterRHD-RHCE(4:505-4:509)-RHD20092012
RHD*17.05DFR-5not reportedPartial DEurasian D clusterRHD-RHCE(3-4)-RHD2007
RHD*18DFWCDePartial DEurasian D clusterRHD(H166P)19982009
RHD*19DHMicDEPartial DEurasian D clusterRHD(T283I)1996
RHD*20DHOCDePartial D
weakened D expression
Eurasian D clusterRHD(K235T)20012001
RHD*21weak D type 21CDeweak D type
Partial D
weakened D expression
Eurasian D clusterRHD(P313L)20012001
RHD*22DHRnot reportedPartial DEurasian D clusterRHD(R229K)19971997
RHD*23DMHcDePartial DEurasian D clusterRHD(L54P)1999
RHD*24DNAKcDEPartial DEurasian D clusterRHD(G357D)2005
RHD*25DNBCDePartial DEurasian D clusterRHD(G355S)20022002
RHD*26DNUcDEPartial DEurasian D clusterRHD(G353R)19971997
RHD*27DDEnot reportedPartial DEurasian D clusterRHD(D40E)2007
RHD*28DFLCDePartial DEurasian D clusterRHD(Y165C)20052007
RHD*29DYUcDePartial DEurasian D clusterRHD(R234W)20032005
RHD*30DTOnot reportedweakened D expression
Partial D
weak D type 4 clusterRHD(F223V,S225F)20052005
RHD*31DVL-1not reportedPartial DEurasian D clusterRHD(229delR)20042006
RHD*32DVL-2not reportedPartial D
weakened D expression
Eurasian D clusterRHD(235delK)20062006
RHD*33DWICDePartial DEurasian D clusterRHD(M358T)20042004
RHD*34DIMcDEPartial D
weakened D expression
Eurasian D clusterRHD(C285Y)20002000
RHD*35DMAcDeEurasian D clusterRHD(L207F)20032003
RHD*36DLOnot reportedweakened D expression
Partial D
Eurasian D clusterRHD(S284L)20032004
RHD*37DUC-2not reportedD positive (apparently normal)Eurasian D clusterRHD(V245L)20052005
RHD*39RHD(S103P)cDEPartial DEurasian D clusterRHD(S103P)19961996
RHD*40D-SPMcDePartial DDIVa clusterRHD(L62F,A137V,N152T,M170T,F223V)2012
RHD*41DBUcDEDEL
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
RHD*42DCCCDePartial DEurasian D clusterRHD(A226D)20072012
RHD*424_426delATGRHD(142delM)not reportedD negativeEurasian D clusterRHD(142delM)
RHD*43DDNnot reportedPartial DEurasian D clusterRHD(D164N)2008
RHD*44DHQnot reportedPartial DEurasian D clusterRHD(H171Q)2004
RHD*443GRHD(T148R)not reportedD negativeEurasian D clusterRHD(T148R)20122012
RHD*45DKKcDEPartial DEurasian D clusterRHD-RHCE(2-3)-RHD20002001
RHD*46DLXcDEPartial DEurasian D clusterRHD(F223V)-RHCE(5:712-6)-RHD20122012
RHD*47DMICDePartial DEurasian D clusterRHD(M170I)20082009
RHD*47.01DMI-1.1CDePartial DEurasian D clusterRHD(M170I)2010
RHD*48DNSnot reportedPartial DEurasian D clusterRHD(N162S)2006
RHD*49DWNcDePartial DEurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20132013
RHD*50RHD(A354T)CDePartial DEurasian D clusterRHD(A354T)20142014
RHD*51RHD(del44L)not reportedPartial DEurasian D clusterRHD(130delCTC)20132014
RHD*52weak D type 141cDePartial D
weakened D expression
weak D type
Eurasian D clusterRHD(F223S)20152016
RHD*53RHD(IVS2-2delA)not reportedDEL
Partial D
Eurasian D clusterRHD(IVS2-2delA)2013
RHD*54RHD(IVS4-2A>C)cDEPartial DEurasian D clusterRHD(IVS4-2A>C)20142014
RHD*55RHD(L81P)not reportedweakened D expression
Partial D
Eurasian D clusterRHD(L81P)2009
RHD*56DBAnot reportedweakened D expressionEurasian D clusterRHD(L227P)20032004
RHD*57weak D type 57not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(L214F)20072007
RHD*58RHD-RHCE(7)-RHDcDEPartial D
D category
Eurasian D clusterRHD-RHCE(7)-RHD2012
RHD*581_582insGRHD(581insG)not reportedEurasian D clusterRHD(581insG)
RHD*59RHD(F175L)not reportedPartial DEurasian D clusterRHD(F175L)20122012
RHD*60RHD(60L,S230I)not reportedEurasian D clusterRHD(I60L,S230I)
RHD*61RHD(D164E)not reportedPartial DEurasian D clusterRHD(D164E)
RHD*62RHD(N152T,V270G)not reportedEurasian D clusterRHD(N152T,V270G)2014
RHD*660delGRHD(660delG)CDeD negativeEurasian D clusterRHD(660delG)20082009
RHD*697delGRHD(697delG)not reportedD negativeEurasian D clusterRHD(697delG)
RHD*702delGRHD(702delG)not reportedD negativeEurasian D clusterRHD(702delG)2017
RHD*896CRHD(L299P)not reportedEurasian D clusterRHD(L299P)2011
RHD*D-SPMD-SPMcDePartial DDIVa clusterRHD(L62F,A137V,N152T,M170T,F223V)2012
RHD*DARDAR(T203A)cDePartial Dweak D type 4 clusterRHD(T201R,T203A,F223V,I342T)20122012
RHD*DAR(SE2:v50V-S68N)DAR(CE2:V50V-S68N)cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
RHD*DAR1.00DAR1 (weak D type 4.2.0)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)19981999
RHD*DAR1.01weak D type 4.2.1 (DAR1.1)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
RHD*DAR1.03weak D type 4.2.3 (DAR1.3)cDeweak D type
Partial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,I342T)[744C]2008
RHD*DAR2DAR-EcDePartial D
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[957G>A]20062006
RHD*DAR2.01DAR2.1not reportedPartial Dweak D type 4 clusterRHD(T201R,F223V,E233Q,I342T)[744C>T, 957G>A]
RHD*DAR3weak D type 4.0cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)[819G>A]19991999
RHD*DAR3weak D type 4.0.1cDeweak D type
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V)
RHD*DAR4weak D type 4.1cDeweak D type
weakened D expression
weak D type 4 clusterRHD(W16C,T201R,F223V)20002000
RHD*DAR6DAR(CE2:V50V-S68N)cDePartial Dweak D type 4 clusterRHD(150T>C,178A>C,201G>A,203G>A,602C>G,667T>G,957G>A,1025T>C)2013
RHD*DAU0DAU-0cDeD positive (apparently normal)
Partial D
DAU clusterRHD(T379M)20022002
RHD*DAU0.01DAU-0.1cDeDAU clusterRHD(579G>A,1136C>T)20032003
RHD*DAU0.02DAU-0.2not reportedEurasian D clusterRHD(150T>C,1136C>T)
RHD*DAU1DAU-1cDePartial DDAU clusterRHD(S230I,T379M)20022002
RHD*DAU10DAU-10not reportedD positive (no further data)DAU clusterRHD(V247L,T379M)[579G>A]20122012
RHD*DAU11DAU-11cDeweakened D expressionDAU clusterRHD(A85V,V279M,T379M)20122016
RHD*DAU12DAU-12cDeDAU clusterRHD(L181P,T379M)2012
RHD*DAU13DAU-13cDeDAU clusterRHD(W16C,T379M)2013
RHD*DAU14DAU-14cDeD positive (no further data)DAU clusterRHD(S68N,T379M)[201G>A]20142014
RHD*DAU15RHD(M1V,T379M)not reportedDAU clusterRHD(M1V,T379M)2008
RHD*DAU2DAU-2cDePartial D
weakened D expression
DAU clusterRHD(R70Q,S333N,T379M)20022002
RHD*DAU3DAU-3cDePartial DDAU clusterRHD(V279M,T379M)20022002
RHD*DAU4DAU-4cDePartial D
weakened D expression
DAU clusterRHD(E233K,T379M)20022002
RHD*DAU5DAU-5cDePartial DDAU clusterRHD(F223V,E233Q,T379M)20052005
RHD*DAU5.01DAU-5.1cDeweakened D expressionDAU clusterRHD(F223V,E233Q,T379M)[1122C>T]20142016
RHD*DAU6DAU-6cDePartial DDAU clusterRHD(S333N,T379M)20052005
RHD*DAU7DAU-7cDePartial DDAU clusterRHD(V279M,S333N,T379M)20092009
RHD*DAU8DAU-8not reportedD positive (no further data)DAU clusterRHD(R114W,T379M)[579G>A]20122012
RHD*DAU9DAU-9not reportedD positive (no further data)DAU clusterRHD(F179L,T379M)20122012
RHD*DBADBAnot reportedweakened D expressionEurasian D clusterRHD(L227P)20032004
RHD*DBS1DBS-1cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:800)-RHD20012001
RHD*DBS2DBS-2cDEPartial DEurasian D clusterRHD-RHcE(5:667-5:697)-RHD20092012
RHD*DBT1DBT-1CDePartial DEurasian D clusterRHD-RHCe(5-7)-RHD19961996
RHD*DBT2DBT-2CDePartial DEurasian D clusterRHD-RHCe(5-9)-RHD19991999
RHD*DBUDBUcDEDEL
Partial D
Eurasian D clusterRHD-cE(5-7;226P)-D20082009
RHD*DCCDCCCDePartial DEurasian D clusterRHD(A226D)20072012
RHD*DCS1DCS-1cDEPartial DEurasian D clusterRHD(F223V,A226P)19992008
RHD*DCS2DCS-2cDEPartial DEurasian D clusterRHD(A226P)20082008
RHD*DDEDDEnot reportedPartial DEurasian D clusterRHD(D40E)2007
RHD*DDNDDNnot reportedPartial DEurasian D clusterRHD(D164N)2008
RHD*DEL1RHD(1227G>A)CDeDELEurasian D clusterRHD(1227G>A)20012001
RHD*DEL10RHD(W408R)CDeDELEurasian D clusterRHD(W408R)20052005
RHD*DEL11RHD(X418L)CDeDELEurasian D clusterRHD(X418L)20052005
RHD*DEL12RHD(L153P)cDEDELEurasian D clusterRHD(L153P)20042009
RHD*DEL13RHD(786del A)CDeD negativeEurasian D clusterRHD(785del A)20042009
RHD*DEL14RHD(IVS4+5G>T)CDeweakened D expressionEurasian D clusterRHD(IVS4+5G>T)20102013
RHD*DEL15RHD(G308X)CDeD negativeEurasian D clusterRHD(G308X)2010
RHD*DEL16RHD(G212R)cDeDELEurasian D clusterRHD(G212R)20082009
RHD*DEL17RHD(Y401X)cDED negativeEurasian D clusterRHD(Y401X)20042005
RHD*DEL18RHD(93insT)CDeDEL
D negative
Eurasian D clusterRHD(93dupT)20082008
RHD*DEL19RHD(IVS4-2A>G)not reportedweakened D expressionEurasian D clusterRHD(IVS4-2A>G)20102011
RHD*DEL2RHD(M1I)not reportedDELEurasian D clusterRHD(M1I)20062006
RHD*DEL20RHD(IVS8-8T>A)not reportedweakened D expressionEurasian D clusterRHD(IVS8-8T>A)20072007
RHD*DEL21RHD(IVS1+5G>C)not reportedDELEurasian D clusterRHD(IVS1+5G>C)2013
RHD*DEL24DEL RHD(A280T)not reportedDELEurasian D clusterRHD(A280T)20142014
RHD*DEL25DEL RHD(X418K)CDeDELEurasian D clusterRHD(X418K)20152015
RHD*DEL26RHD(1248insG)CDeDELEurasian D clusterRHD(1248insG)20142014
RHD*DEL28RHD(993delC)not reportedEurasian D clusterRHD(993delC)2014
RHD*DEL29RHD(D404H)cDEDELEurasian D clusterRHD(D404H)2012
RHD*DEL3RHD(L18P)not reportedDELEurasian D clusterRHD(L18P)20062006
RHD*DEL30RHD(del Ex8)not reportedDELEurasian D clusterRHD(del Ex8)20072007
RHD*DEL31RHD(IVS1+1G>T)cDEDELEurasian D clusterRHD(1481G>T)20142014
RHD*DEL32RHD(IVS1-29G>C)CDeDELEurasian D clusterRHD(IVS1-29G>C)2012
RHD*DEL33RHD(IVS2-2A>G)not reportedDELEurasian D clusterRHD(IVS2-2A>G)20112011
RHD*DEL36RHD(IVS7+152C>A,1227G>A)CDeDELEurasian D clusterRHD(IVS7+152C>A,1227G>A)20022002
RHD*DEL37RHD(IVS8-31C>T)not reportedDELEurasian D clusterRHD(IVS8-31C>T)2012
RHD*DEL38RHD(L337R)CDeD negative
DEL
Eurasian D clusterRHD(L337R)20142014
RHD*DEL39RHD(L38X)not reportedDELEurasian D clusterRHD(L38X)2010
RHD*DEL4RHD(147del A)CDeDELEurasian D clusterRHD(147del A)20042009
RHD*DEL40RHD(L93R)CDeDELEurasian D clusterRHD(L93R)20142014
RHD*DEL41RHD(P291R)CDeDELEurasian D clusterRHD(P291R)2012
RHD*DEL42RHD(S112T)not reportedDELEurasian D clusterRHD(S112T)2012
RHD*DEL43RHD(W16R)cDEDELEurasian D clusterRHD(W16R)2012
RHD*DEL44RHD-RHCE(4-9)-RHDCDeDELEurasian D clusterRHD-RHCE(4-9)-RHD20092009
RHD*DEL45RHD(T241P)not reportedEurasian D clusterRHD(T241P)
RHD*DEL5RHD(IVS1+1G>A)not reportedDELEurasian D clusterRHD(IVS1+1G>A)2001
RHD*DEL6RHD(L84P)not reportedDELEurasian D clusterRHD(L84P)20062006
RHD*DEL7RHD(A137E)CDeDELEurasian D clusterRHD(A137E)20062009
RHD*DEL8RHD(IVS3+1G>A)CDeDEL
D negative
Eurasian D clusterRHD(IVS3+1G>A)20012001
RHD*DEL9RHD(IVS3+2T>A)cDED negativeEurasian D clusterRHD(IVS3+2T>A)20082009
RHD*DFLDFLCDePartial DEurasian D clusterRHD(Y165C)20052007
RHD*DFR1DFR-1multiplePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD19951995
RHD*DFR2DFR-2CDePartial DEurasian D clusterRHD-RHCE(4)-RHD19971997
RHD*DFR3DFR-3CDePartial DEurasian D clusterRHD-RHCE(4:505-4:514)-RHD(G180A)20072007
RHD*DFR4DFR-4CDePartial DEurasian D clusterRHD-RHCE(4:505-4:509)-RHD20092012
RHD*DFR5DFR-5not reportedPartial DEurasian D clusterRHD-RHCE(3-4)-RHD2007
RHD*DFVDFVmultiplePartial Dweak D type 4 clusterRHD(F223V)20022002
RHD*DFWDFWCDePartial DEurasian D clusterRHD(H166P)19982009
RHD*DHMiDHMicDEPartial DEurasian D clusterRHD(T283I)1996
RHD*DHODHOCDePartial D
weakened D expression
Eurasian D clusterRHD(K235T)20012001
RHD*DHQDHQnot reportedPartial DEurasian D clusterRHD(H171Q)2004
RHD*DHRDHRnot reportedPartial DEurasian D clusterRHD(R229K)19971997
RHD*DIIDIICDePartial D
D category
Eurasian D clusterRHD(A354D)19971997
RHD*DII.04.02DIII type 4.2not reportedEurasian D clusterRHD(L62F,S103P,A137V,N152T)
RHD*DIII.07DIII type 7cDePartial D
D category
DIVa clusterRHD-RHCE(2)-RHD(A137V,N152T,T201R,F223V)20052006
RHD*DIII.08DIII type 8not reportedPartial D
D category
DIVa clusterRHD(A137V,N152T)2010
RHD*DIII.09DIII type 9not reportedPartial DDIVa clusterRHD(L62F,A137V,N152T,F223V)
RHD*DIII.4DIII type 4CDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T)20002000
RHD*DIII.6DIII type 6cDePartial D
D category
DIVa clusterRHD(A137V,N152T,T201R,F223V,A273A)20052006
RHD*DIIIaDIII type 5cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,T201R,F223V)
RHD*DIIIcDIIIcCDePartial D
D category
Eurasian D clusterRHD-RHCE(3)-RHD19961996
RHD*DIMDIMcDEPartial D
weakened D expression
Eurasian D clusterRHD(C285Y)20002000
RHD*DIV.4DIV type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(7:1048-7:1061)-RHD1998
RHD*DIV.5DIV type 5cDEPartial D
D category
Eurasian D clusterRHD-RHCE(7-9)-RHD20002000
RHD*DIVa.DIV type 1.0cDePartial D
D category
DIVa clusterRHD(L62F,A137V,N152T,D350H)2012
RHD*DKKDKKcDEPartial DEurasian D clusterRHD-RHCE(2-3)-RHD20002001
RHD*DLODLOnot reportedweakened D expression
Partial D
Eurasian D clusterRHD(S284L)20032004
RHD*DLXDLXcDEPartial DEurasian D clusterRHD(F223V)-RHCE(5:712-6)-RHD20122012
RHD*DMADMAcDeEurasian D clusterRHD(L207F)20032003
RHD*DMHDMHcDePartial DEurasian D clusterRHD(L54P)1999
RHD*DMIDMICDePartial DEurasian D clusterRHD(M170I)20082009
RHD*DMI-1.1DMI-1.1CDePartial DEurasian D clusterRHD(M170I)2010
RHD*DNAKDNAKcDEPartial DEurasian D clusterRHD(G357D)2005
RHD*DNBDNBCDePartial DEurasian D clusterRHD(G355S)20022002
RHD*DNSDNSnot reportedPartial DEurasian D clusterRHD(N162S)2006
RHD*DNUDNUcDEPartial DEurasian D clusterRHD(G353R)19971997
RHD*DOL1DOL-1cDePartial Dweak D type 4 clusterRHD(M170T,F223V)19992009
RHD*DOL2DOL-2not reportedPartial Dweak D type 4 clusterRHD(M170T,F223V,L378V)20052009
RHD*DOL3DOL-3not reportedPartial Dweak D type 4 clusterRHD(A137V,M170T,F223V)2005
RHD*DOL4DOL-4not reportedPartial DDIVa cluster
RHD*DTODTOnot reportedweakened D expression
Partial D
weak D type 4 clusterRHD(F223V,S225F)20052005
RHD*DUC2DUC-2not reportedD positive (apparently normal)Eurasian D clusterRHD(V245L)20052005
RHD*DV.1DV type 1CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:697)-RHD19951995
RHD*DV.10DV type 10not reportedPartial DEurasian D clusterRHD-RHCE(5-6)-RHD
RHD*DV.2DV type 2CDePartial D
D category
Eurasian D clusterRHD-RHCE(5)-RHD19951995
RHD*DV.3DBS-0CDePartial DEurasian D clusterRHD-RHcE(5:667-5:712)-RHD19961996
RHD*DV.4DV type 4CDePartial D
D category
Eurasian D clusterRHD(E233Q)19981999
RHD*DV.5DHKCDePartial DEurasian D clusterRHD(E233K)19981999
RHD*DV.6DV type 6CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:712)-RHD19981999
RHD*DV.7DV type 7CDeD category
Partial D
Eurasian D clusterRHD-RHCE(5:667-5:787)-RHD20012001
RHD*DV.8DV type 8CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:667-5:744)-RHD19981999
RHD*DV.9DV type 9CDePartial D
D category
Eurasian D clusterRHD-RHCE(5:697-5:712)-RHD19992000
RHD*DVI.03.02DVI type 3.2not reportedPartial DEurasian D clusterRHD-RHCE(3-6)-RHD(A399T)
RHD*DVI.1DVI type 1cDED category
Partial D
Eurasian D clusterRHD-RHcE(4-5)-RHD19971997
RHD*DVI.2DVI type 2CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(4-6)-RHD19941994
RHD*DVI.3DVI type 3CDePartial D
D category
BARC positive
Eurasian D clusterRHD-RHCE(3-6)-RHD19981998
RHD*DVI.4DVI type 4CDePartial D
D category
Eurasian D clusterRHD-RHCE(3-5)-RHD20002006
RHD*DVII.1DVIICDePartial D
D category
Eurasian D clusterRHD(L110P)19951995
RHD*DVII.2DVII type 2CDePartial DEurasian D clusterRHD(S103P,L110P)20012001
RHD*DVL1DVL-1not reportedPartial DEurasian D clusterRHD(229delR)20042006
RHD*DVL2DVL-2not reportedPartial D
weakened D expression
Eurasian D clusterRHD(235delK)20062006
RHD*DWIDWICDePartial DEurasian D clusterRHD(M358T)20042004
RHD*DWNDWNcDePartial DEurasian D clusterRHD-RHCE(7:1053-7:1061)-RHD20132013
RHD*DYUDYUcDePartial DEurasian D clusterRHD(R234W)20032005
RHD*PseudogeneRHD psicDeD negativeweak D type 4 clusterRHD(486-19duplication ttactgggttttattgcagacagactaccacatgaac,609G>A,654G>C,674C>T,807T>G)20002000
RHD*weak 4.2weak D type 4.2.1 (DAR1.1)cDePartial D
weak D type
weakened D expression
weak D type 4 clusterRHD(T201R,F223V,,I342T)[957G>A]20002000
RHD*weak 4.3weak D type 4.3cDeweak D type
DEL
weakened D expression
Partial D
weak D type 4 clusterRHD(T201R,F223V,P291R)[819G>A]2004
RHD*weak D type 1weak D type 1CDeweak D type
weakened D expression
Eurasian D clusterRHD(V270G)19991999
RHD*weak D type 1.1weak D type 1.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(L18V,V270G)20042005
RHD*weak D type 1.2weak D type 1.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(V238M,V270G)20142014
RHD*weak D type 10weak D type 10cDEweak D type
weakened D expression
Eurasian D clusterRHD(W393R)19991999
RHD*weak D type 10.1weak D type 10.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P,W393R)2016
RHD*weak D type 10.2weak D type 10.2not reportedweakened D expression
weak D type
Eurasian D clusterRHD(W393R,K400T)20152016
RHD*weak D type 100weak D type 100CDeweak D type
weakened D expression
Eurasian D clusterRHD(G263R)2010
RHD*weak D type 101weak D type 101not reportedweakened D expression
weak D type
Eurasian D clusterRHD(E21A)2015
RHD*weak D type 102weak D type 102multipleweakened D expression
weak D type
Eurasian D clusterRHD(I25F)2016
RHD*weak D type 103weak D type 103not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F31I)2015
RHD*weak D type 104RHD(D53Y)not reportedweakened D expressionEurasian D clusterRHD(D53Y)2015
RHD*weak D type 105weak D type 105not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S67W)20152015
RHD*weak D type 106weak D type 106cDEweak D type
weakened D expression
Eurasian D clusterRHD(W74G)20152015
RHD*weak D type 107weak D type 107not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S75C)2015
RHD*weak D type 108RHD(G96D)not reportedweakened D expressionEurasian D clusterRHD(G96D)20152015
RHD*weak D type 109weak D type 109not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S126P)2015
RHD*weak D type 110weak D type 110not reportedweakened D expression
weak D type
Eurasian D clusterRHD(Q138R)20152015
RHD*weak D type 111weak D type 111not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212S)2015
RHD*weak D type 112weak D type 112not reportedweakened D expression
weak D type
Eurasian D clusterRHD(G212D)20152015
RHD*weak D type 113weak D type 113not reportedweak D type
weakened D expression
Eurasian D clusterRHD(W292R)2015
RHD*weak D type 114weak D type 114not reportedweakened D expression
weak D type
Eurasian D clusterRHD(P323L)20152015
RHD*weak D type 115weak D type 115CDeweakened D expression
weak D type
Eurasian D clusterRHD(M328K)20152015
RHD*weak D type 116weak D type 116not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116P)20152015
RHD*weak D type 117weak D type 117not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116T)2015
RHD*weak D type 118weak D type 118not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A116V)2010
RHD*weak D type 119weak D type 119CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273V)2010
RHD*weak D type 12weak D type 12CDeweak D type
weakened D expression
Eurasian D clusterRHD(G277E)19991999
RHD*weak D type 120weak D type 120CDeweakened D expression
weak D type
Eurasian D clusterRHD(A273E)2010
RHD*weak D type 121weak D type 121not reportedweakened D expression
weak D type
Eurasian D clusterRHD(A59D)2015
RHD*weak D type 122weak D type 122not reportedweakened D expression
weak D type
Eurasian D clusterRHD(R70W)2011
RHD*weak D type 123weak D type 123not reportedweakened D expression
weakened D expression
Eurasian D clusterRHD(V127L)2015
RHD*weak D type 124weak D type 124not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K198N)2015
RHD*weak D type 125weak D type 125not reportedweakened D expression
weak D type
Eurasian D clusterRHD(N224S)2015
RHD*weak D type 126weak D type 126not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K400I)2015
RHD*weak D type 127weak D type 127not reportedweakened D expression
weak D type
Eurasian D clusterRHD(K400N)20122012
RHD*weak D type 128weak D type 128not reportedweakened D expression
weak D type
Eurasian D clusterRHD(D403Y)2015
RHD*weak D type 129weak D type 129CDeweakened D expression
weak D type
Eurasian D clusterRHD(D403V)20122012
RHD*weak D type 13weak D type 13CDeweak D type
weakened D expression
Eurasian D clusterRHD(A276P)19991999
RHD*weak D type 130weak D type 130CDeweakened D expression
weak D type
Eurasian D clusterRHD(T55P)20112012
RHD*weak D type 131weak D type 131CDeweakened D expression
weak D type
Eurasian D clusterRHD(A85G)20122012
RHD*weak D type 132weak D type 132CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132R)20102012
RHD*weak D type 133weak D type 133CDeweakened D expression
weak D type
Eurasian D clusterRHD(G132E)20122012
RHD*weak D type 134weak D type 134not reportedweak D typeEurasian D clusterRHD(L390V)20122012
RHD*weak D type 135weak D type 135not reportedweak D type
weakened D expression
Eurasian D clusterRHD(M295K)2016
RHD*weak D type 136weak D type 136not reportedweak D typeEurasian D clusterRHD(P14L)2016
RHD*weak D type 137weak D type 137not reported
weak D type
Eurasian D clusterRHD(H260Q)2016
RHD*weak D type 138weak D type 138not reportedweak D typeEurasian D clusterRHD(P291S)2016
RHD*weak D type 139weak D type 139not reported
weak D type
Eurasian D clusterRHD(L390P)2016
RHD*weak D type 14weak D type 14cDEweak D type
weakened D expression
Eurasian D clusterRHD(S182T,K198N,T201R)19991999
RHD*weak D type 140weak D type 140not reportedweakened D expression
weak D type
Eurasian D clusterRHD(F410S)20162016
RHD*weak D type 142weak D type 142CDeweakened D expression
weak D type
Eurasian D clusterRHD(A23S)2016
RHD*weak D type 143weak D type 143CDeweakened D expression
weak D type
Eurasian D clusterRHD(A58V)2015
RHD*weak D type 144weak D type 144CDeweakened D expression
weak D type
Eurasian D clusterRHD(E193D)2016
RHD*weak D type 145weak D type 145not reportedEurasian D clusterRHD(P14R)
RHD*weak D type 16weak D type 16cDEweak D type
weakened D expression
Eurasian D clusterRHD(W220R)19991999
RHD*weak D type 17weak D type 17CDEweak D type
weakened D expression
Eurasian D clusterRHD(R114W)20002000
RHD*weak D type 18weak D type 18not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R7W)2000
RHD*weak D type 19weak D type 19cDeweak D type
weakened D expression
Eurasian D clusterRHD(I204T)20062006
RHD*weak D type 2weak D type 2cDEweak D type
weakened D expression
Eurasian D clusterRHD(G385A)19991999
RHD*weak D type 2.1weak D type 2.1cDEweak D type
weakened D expression
Eurasian D clusterRHD(F101I,G385A)2009
RHD*weak D type 2.2weak D type 2.2cDEweak D type
weakened D expression
Eurasian D clusterRHD(V306I,Y311C,G385A)20142014
RHD*weak D type 20weak D type 20cDEweak D typeEurasian D clusterRHD(F417S)20002006
RHD*weak D type 22weak D type 22CDeweak D type
weakened D expression
Eurasian D clusterRHD(W408C)2000
RHD*weak D type 23weak D type 23not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G212C)20012001
RHD*weak D type 24weak D type 24not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L338P)20032003
RHD*weak D type 25weak D type 25not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114Q)2005
RHD*weak D type 26weak D type 26CDeweak D type
weakened D expression
Eurasian D clusterRHD(V9D)20042005
RHD*weak D type 27weak D type 27not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221S)2002
RHD*weak D type 28weak D type 28not reportedweak D type
weakened D expression
Eurasian D clusterRHD(1152A>C)2002
RHD*weak D type 29weak D type 29cDeweak D type
weakened D expression
weak D type 4 clusterRHD(I60L,S68N,K198N,F223V,I342T)20032003
RHD*weak D type 3weak D type 3CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C)19991999
RHD*weak D type 3.1weak D type 3.1CDeweak D type
weakened D expression
Eurasian D clusterRHD(S3C,I60L)20142014
RHD*weak D type 30weak D type 30not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E340M)2003
RHD*weak D type 31weak D type 31CDeweak D type
weakened D expression
Eurasian D clusterRHD(P6L)20042005
RHD*weak D type 32weak D type 32CDeweak D type
weakened D expression
Eurasian D clusterRHD(I374N)20052005
RHD*weak D type 33weak D type 33CDeweak D type
weakened D expression
Eurasian D clusterRHD(V174M)20032003
RHD*weak D type 34weak D type 34not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V270E)20032003
RHD*weak D type 35weak D type 35not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G87D)2003
RHD*weak D type 36weak D type 36not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V281G)2004
RHD*weak D type 37weak D type 37not reportedweak D type
weakened D expression
Eurasian D clusterRHD(K133N)20032004
RHD*weak D type 38weak D type 38CDeweak D type
weakened D expression
Eurasian D clusterRHD(G278D)20032004
RHD*weak D type 39weak D type 39CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339R)2003
RHD*weak D type 40weak D type 40not reportedweak D type
weakened D expression
Eurasian D clusterRHD(T201R)2003
RHD*weak D type 41weak D type 41not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398V)2004
RHD*weak D type 41.01.weak D type 41.0.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L390L,E398V)2016
RHD*weak D type 42weak D type 42not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(K409M)20052005
RHD*weak D type 43weak D type 43CDeweak D type
weakened D expression
Eurasian D clusterRHD(A202V)20062006
RHD*weak D type 44weak D type 44not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243C)2004
RHD*weak D type 45weak D type 45not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(A399T)2004
RHD*weak D type 46weak D type 46not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F407L)2004
RHD*weak D type 47weak D type 47not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R114G)2005
RHD*weak D type 48weak D type 48cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61V)2005
RHD*weak D type 49weak D type 49CDeweak D type
weakened D expression
Eurasian D clusterRHD(S257F)20062007
RHD*weak D type 5weak D type 5cDEweak D type
weakened D expression
Eurasian D clusterRHD(A149D)19991999
RHD*weak D type 50weak D type 50not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Y243N)2006
RHD*weak D type 51weak D type 51not reportedweak D type
weakened D expression
Eurasian D clusterRHD-RHCE(4:594-4:602)-RHD2005
RHD*weak D type 52weak D type 52not reportedweak D type
weakened D expression
Eurasian D clusterRHD(F31S)2005
RHD*weak D type 53weak D type 53CDeweak D type
weakened D expression
Eurasian D clusterRHD(V247G)2005
RHD*weak D type 54weak D type 54cDEweak D type
weakened D expression
Eurasian D clusterRHD(S122L)
RHD*weak D type 55weak D type 55cDEweak D type
weakened D expression
Eurasian D clusterRHD(L299V)2007
RHD*weak D type 56weak D type 56not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A22E)20072007
RHD*weak D type 58weak D type 58CDeweak D type
weakened D expression
Eurasian D clusterRHD(G336R)20072007
RHD*weak D type 59weak D type 59not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L383P)20072007
RHD*weak D type 6weak D type 6CDeweak D type
weakened D expression
Eurasian D clusterRHD(R10Q)19991999
RHD*weak D type 60weak D type 60not reportedweak D type
weakened D expression
Eurasian D clusterRHD(407delFW)20072007
RHD*weak D type 61weak D type 61CDeweak D type
weakened D expression
DEL
Eurasian D clusterRHD(R10W)20062006
RHD*weak D type 62weak D type 62not reportedweak D type
weakened D expression
Eurasian D clusterRHD(P221T)2006
RHD*weak D type 63weak D type 63not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I253N)2007
RHD*weak D type 64weak D type 64not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A294V)2007
RHD*weak D type 65weak D type 65cDeweak D type
weakened D expression
Eurasian D clusterRHD(A23D)2008
RHD*weak D type 66weak D type 66CDeweak D type
weakened D expression
Eurasian D clusterRHD(V306I)2007
RHD*weak D type 67weak D type 67cDEweak D type
weakened D expression
Eurasian D clusterRHD(T241I)2008
RHD*weak D type 68weak D type 68not reportedweak D type
weakened D expression
Eurasian D clusterRHD(165C>T,1213C>G)2006
RHD*weak D type 69weak D type 69not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R318Q)2008
RHD*weak D type 7weak D type 7CDeweak D type
weakened D expression
Eurasian D clusterRHD(G339E)19991999
RHD*weak D type 70weak D type 70CDeweak D type
weakened D expression
Eurasian D clusterRHD(L338V)2008
RHD*weak D type 71weak D type 71not reportedweak D type
weakened D expression
Eurasian D clusterRHD(R10P)2009
RHD*weak D type 72weak D type 72not reportedweak D type
weakened D expression
Eurasian D clusterRHD(D404E)2007
RHD*weak D type 73weak D type 73not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A414V)2009
RHD*weak D type 74weak D type 74not reportedweak D type
weakened D expression
Eurasian D clusterRHD(S68T)2009
RHD*weak D type 75weak D type 75not reportedweak D type
weakened D expression
Eurasian D clusterRHD(E398D)2010
RHD*weak D type 76weak D type 76not reportedweak D type
weakened D expression
Eurasian D clusterRHD(Q405H)2010
RHD*weak D type 77weak D type 77not reportedweakened D expression
weak D type
Eurasian D clusterRHD(S256P)20102011
RHD*weak D type 78weak D type 78CDeweakened D expression
weak D type
Eurasian D clusterRHD(F410V)20092011
RHD*weak D type 79weak D type 79not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L187P)2012
RHD*weak D type 8weak D type 8CDeweak D type
weakened D expression
Eurasian D clusterRHD(G307R)19991999
RHD*weak D type 80weak D type 80not reportedweak D type
weakened D expression
Eurasian D clusterRHD(G180E)2012
RHD*weak D type 81weak D type 81CDeweak D type
weakened D expression
Eurasian D clusterRHD(K400T)2012
RHD*weak D type 82weak D type 82CDeweak D type
weakened D expression
Eurasian D clusterRHD(A395V)2012
RHD*weak D type 83weak D type 83cDEweakened D expressionEurasian D clusterRHD(L413W)2012
RHD*weak D type 84weak D type 84CDeweak D type
weakened D expression
Eurasian D clusterRHD(S76N)2013
RHD*weak D type 85weak D type 85CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70Q)2010
RHD*weak D type 86weak D type 86not reportedweak D type
weakened D expression
Eurasian D clusterRHD(V345E)2014
RHD*weak D type 87weak D type 87not reportedweak D type
weakened D expression
Eurasian D clusterRHD(I125N)20142015
RHD*weak D type 88weak D type 88cDEweak D type
weakened D expression
Eurasian D clusterRHD(G61A)2014
RHD*weak D type 89weak D type 89CDeweak D type
weakened D expression
Eurasian D clusterRHD(A23P)20142014
RHD*weak D type 9weak D type 9cDEweak D type
weakened D expression
Eurasian D clusterRHD(A294P)19991999
RHD*weak D type 90weak D type 90CDeweak D type
weakened D expression
Eurasian D clusterRHD(N331K)20142014
RHD*weak D type 91weak D type 91CDeweak D type
weakened D expression
Eurasian D clusterRHD(P396R)20142014
RHD*weak D type 92weak D type 92not reportedweak D type
weakened D expression
Eurasian D clusterRHD(L382P)20142014
RHD*weak D type 93weak D type 93cDEweak D type
weakened D expression
Eurasian D clusterRHD(A120D)2016
RHD*weak D type 94weak D type 94CDeweak D type
weakened D expression
Eurasian D clusterRHD(M295T)20122013
RHD*weak D type 95weak D type 95cDEweak D type
weakened D expression
Eurasian D clusterRHD(A244P)20132013
RHD*weak D type 96weak D type 96cDeweak D type
weakened D expression
Eurasian D clusterRHD(A244V)20132013
RHD*weak D type 97weak D type 97CDeweak D type
weakened D expression
Eurasian D clusterRHD(L181P)20132013
RHD*weak D type 98weak D type 98cDEweak D type
weakened D expression
Eurasian D clusterRHD(T251P)20132013
RHD*weak D type 99weak D type 99CDeweak D type
weakened D expression
Eurasian D clusterRHD(E369D)20132013
RHD*weak partial 11RHD(M295I)CDeDEL
Partial D
Eurasian D clusterRHD(M295I)20012001
RHD*weak partial 11weak D type 11cDeweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(M295I)19991999
RHD*weak partial 15weak D type 15cDEweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(G282D)19991999
RHD*weak partial 57weak D type 57not reportedweak D type
weakened D expression
Partial D
Eurasian D clusterRHD(L214F)20072007
RHD*weak partial D 21weak D type 21CDeweak D type
Partial D
weakened D expression
Eurasian D clusterRHD(P313L)20012001
RHDÜweak D type 45.1weak D type 45.1not reportedweak D type
weakened D expression
Eurasian D clusterRHD(A273V,A399T)2010
RHDÜweak D type 45.2weak D type 45.2CDeweak D type
weakened D expression
Eurasian D clusterRHD(R70W,A273V,A399T)20132013